Incidental Mutation 'R7108:Frem2'
ID551301
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53653513 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1191 (E1191G)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: E1191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: E1191G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7932:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCTATAATCTGATCCAGGGTGAAGC -3'
(R):5'- AAATCAAGAGCCGGGGTTGC -3'

Sequencing Primer
(F):5'- GGTGAAGCTTTCAACCAACACTG -3'
(R):5'- TTCACGCTGAAGGATCTCAG -3'
Posted On2019-05-15