Incidental Mutation 'R7108:Tek'
ID551306
Institutional Source Beutler Lab
Gene Symbol Tek
Ensembl Gene ENSMUSG00000006386
Gene NameTEK receptor tyrosine kinase
SynonymsCd202b, Hyk, tie-2, Tie2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location94739289-94874976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94853487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 827 (D827V)
Ref Sequence ENSEMBL: ENSMUSP00000099862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]
Predicted Effect probably damaging
Transcript: ENSMUST00000071168
AA Change: D826V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: D826V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 1.2e-57 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.35e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 822 1090 1.9e-138 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073939
AA Change: D776V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: D776V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 7.1e-58 PFAM
EGF_Lam 176 213 1.26e-2 SMART
EGF 216 248 2.2e1 SMART
internal_repeat_1 251 295 4.22e-7 PROSPERO
FN3 394 475 2.11e0 SMART
FN3 490 573 9.77e-5 SMART
FN3 587 669 1.18e-12 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 772 1040 1.9e-138 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102798
AA Change: D827V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: D827V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 24 118 5e-44 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.36e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 823 1091 1.9e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Tek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Tek APN 4 94827301 missense probably benign 0.03
IGL00805:Tek APN 4 94798719 missense probably damaging 1.00
IGL00806:Tek APN 4 94798719 missense probably damaging 1.00
IGL00807:Tek APN 4 94798719 missense probably damaging 1.00
IGL00870:Tek APN 4 94873081 nonsense probably null
IGL01348:Tek APN 4 94859658 missense probably damaging 1.00
IGL01398:Tek APN 4 94849777 missense probably damaging 1.00
IGL01683:Tek APN 4 94858911 missense probably damaging 1.00
IGL01827:Tek APN 4 94739645 missense probably benign 0.24
IGL02063:Tek APN 4 94739645 missense probably benign 0.24
IGL02218:Tek APN 4 94855337 missense probably damaging 1.00
IGL02502:Tek APN 4 94853581 critical splice donor site probably null
IGL02852:Tek APN 4 94855324 missense probably damaging 1.00
IGL02995:Tek APN 4 94739640 utr 5 prime probably benign
IGL03182:Tek APN 4 94851765 missense probably damaging 1.00
IGL03247:Tek APN 4 94865443 missense possibly damaging 0.85
IGL03014:Tek UTSW 4 94827263 missense probably benign 0.05
R0022:Tek UTSW 4 94837272 missense probably damaging 0.98
R0373:Tek UTSW 4 94804341 missense probably damaging 1.00
R0479:Tek UTSW 4 94804312 missense probably benign 0.01
R1178:Tek UTSW 4 94804287 missense probably damaging 1.00
R1289:Tek UTSW 4 94804830 missense probably damaging 1.00
R1331:Tek UTSW 4 94739706 splice site probably benign
R1502:Tek UTSW 4 94781102 missense probably damaging 1.00
R1606:Tek UTSW 4 94849767 missense probably damaging 0.99
R2073:Tek UTSW 4 94827729 missense probably benign 0.01
R2075:Tek UTSW 4 94827729 missense probably benign 0.01
R2230:Tek UTSW 4 94811336 missense probably damaging 1.00
R2851:Tek UTSW 4 94820224 missense probably benign 0.30
R2852:Tek UTSW 4 94820224 missense probably benign 0.30
R3775:Tek UTSW 4 94804312 missense probably benign 0.01
R3845:Tek UTSW 4 94804872 missense probably damaging 1.00
R4114:Tek UTSW 4 94849683 missense probably damaging 0.99
R4115:Tek UTSW 4 94849683 missense probably damaging 0.99
R4273:Tek UTSW 4 94829970 missense probably damaging 1.00
R4425:Tek UTSW 4 94863667 missense probably damaging 1.00
R4488:Tek UTSW 4 94849756 missense possibly damaging 0.72
R4579:Tek UTSW 4 94863666 nonsense probably null
R4623:Tek UTSW 4 94863661 missense probably damaging 1.00
R4651:Tek UTSW 4 94780884 missense probably damaging 1.00
R4652:Tek UTSW 4 94780884 missense probably damaging 1.00
R4723:Tek UTSW 4 94799160 missense possibly damaging 0.71
R5059:Tek UTSW 4 94804314 missense probably benign 0.10
R5652:Tek UTSW 4 94855324 missense probably damaging 1.00
R5793:Tek UTSW 4 94820096 missense probably benign 0.01
R5855:Tek UTSW 4 94853553 missense probably damaging 1.00
R5912:Tek UTSW 4 94798640 missense probably damaging 1.00
R6537:Tek UTSW 4 94837324 missense probably benign 0.19
R6727:Tek UTSW 4 94853495 nonsense probably null
R6835:Tek UTSW 4 94853434 missense possibly damaging 0.94
R6883:Tek UTSW 4 94837189 missense possibly damaging 0.89
R6887:Tek UTSW 4 94804944 missense probably damaging 1.00
R7027:Tek UTSW 4 94865510 missense probably damaging 1.00
R7121:Tek UTSW 4 94811410 missense probably benign 0.19
R7220:Tek UTSW 4 94804304 missense probably damaging 1.00
R7346:Tek UTSW 4 94827296 missense probably benign
R7417:Tek UTSW 4 94811345 missense probably benign
R7465:Tek UTSW 4 94827826 critical splice donor site probably null
R7818:Tek UTSW 4 94827716 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCTGTGTAGATACAAAGCAGATGATAG -3'
(R):5'- TCAGAGCAACTCCTGGTTCG -3'

Sequencing Primer
(F):5'- GTATGCACCTTAGGATGACAAATGTC -3'
(R):5'- TCGAAGAATATATGGCCACAAAGG -3'
Posted On2019-05-15