Incidental Mutation 'R7108:Lrrc17'
ID551310
Institutional Source Beutler Lab
Gene Symbol Lrrc17
Ensembl Gene ENSMUSG00000039883
Gene Nameleucine rich repeat containing 17
Synonyms6130400C22Rik, 37kDa, 4833425M04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21543559-21575904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21575339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 437 (V437A)
Ref Sequence ENSEMBL: ENSMUSP00000038569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035651] [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035651
AA Change: V437A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038569
Gene: ENSMUSG00000039883
AA Change: V437A

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:LRR 83 105 8e-6 BLAST
LRR 106 129 9.96e-1 SMART
LRR 130 153 1.07e0 SMART
LRRCT 165 215 8.98e-4 SMART
LRR 270 292 8.73e1 SMART
LRR 293 316 3.52e-1 SMART
LRR 317 340 7.55e-1 SMART
LRRCT 352 403 8.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051358
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Lrrc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Lrrc17 APN 5 21575271 missense probably benign 0.05
IGL01289:Lrrc17 APN 5 21560901 missense probably damaging 1.00
IGL01549:Lrrc17 APN 5 21570290 missense probably benign 0.00
IGL02105:Lrrc17 APN 5 21570257 missense probably benign 0.30
IGL02371:Lrrc17 APN 5 21560996 missense probably damaging 1.00
IGL02412:Lrrc17 APN 5 21560879 missense possibly damaging 0.68
IGL02587:Lrrc17 APN 5 21561080 missense probably damaging 1.00
R0255:Lrrc17 UTSW 5 21560969 missense probably benign 0.09
R0504:Lrrc17 UTSW 5 21560530 missense probably benign 0.05
R0883:Lrrc17 UTSW 5 21561278 missense probably benign 0.06
R1875:Lrrc17 UTSW 5 21560652 missense possibly damaging 0.85
R2168:Lrrc17 UTSW 5 21575048 missense probably damaging 0.97
R5057:Lrrc17 UTSW 5 21575309 missense probably benign 0.25
R5326:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5542:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5574:Lrrc17 UTSW 5 21570357 missense possibly damaging 0.90
R5872:Lrrc17 UTSW 5 21575266 missense probably benign 0.01
R7715:Lrrc17 UTSW 5 21561080 missense probably damaging 1.00
R7766:Lrrc17 UTSW 5 21561044 missense probably benign 0.03
X0026:Lrrc17 UTSW 5 21561020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGGAATGCAAAACGCCG -3'
(R):5'- GCTTGATTACCCTGCATAATAGG -3'

Sequencing Primer
(F):5'- TGCAAAACGCCGGAAGAATAC -3'
(R):5'- TTTTCCAGAGCTGAGGACCGAAC -3'
Posted On2019-05-15