Incidental Mutation 'R7108:Fry'
ID 551315
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene Name FRY microtubule binding protein
Synonyms 9330186A19Rik, cg003
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock # R7108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 150118645-150497753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150395786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 972 (V972A)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087204
AA Change: V972A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: V972A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
Brook UTSW 5 150326132 missense probably damaging 1.00
haydn UTSW 5 150418464 missense possibly damaging 0.94
miracle UTSW 5 150437159 missense probably damaging 0.99
quickening UTSW 5 150434776 missense probably damaging 1.00
seasons UTSW 5 150466437 missense probably benign 0.06
Vivaldi UTSW 5 150394138 missense possibly damaging 0.80
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense
R4733:Fry UTSW 5 150386007 missense
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R7972:Fry UTSW 5 150310396 missense probably benign 0.05
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
R8159:Fry UTSW 5 150399533 missense probably benign 0.31
R8202:Fry UTSW 5 150431737 missense probably damaging 1.00
R8261:Fry UTSW 5 150445907 missense probably damaging 1.00
R8279:Fry UTSW 5 150496261 missense
R8338:Fry UTSW 5 150359051 missense probably damaging 0.99
R8370:Fry UTSW 5 150395819 missense probably damaging 1.00
R8673:Fry UTSW 5 150395111 missense possibly damaging 0.91
R8786:Fry UTSW 5 150394036 missense probably benign 0.00
R8815:Fry UTSW 5 150394138 missense possibly damaging 0.80
R8847:Fry UTSW 5 150386007 missense
R9023:Fry UTSW 5 150437303 missense probably benign 0.00
R9025:Fry UTSW 5 150295808 intron probably benign
R9125:Fry UTSW 5 150346060 missense probably damaging 0.97
R9172:Fry UTSW 5 150413328 missense probably benign
R9262:Fry UTSW 5 150381644 missense probably damaging 1.00
R9263:Fry UTSW 5 150399263 missense probably damaging 1.00
R9293:Fry UTSW 5 150495832 missense
R9368:Fry UTSW 5 150477938 missense
R9401:Fry UTSW 5 150378938 missense probably damaging 1.00
R9402:Fry UTSW 5 150433696 missense possibly damaging 0.91
R9402:Fry UTSW 5 150436853 missense probably damaging 1.00
R9420:Fry UTSW 5 150433529 missense possibly damaging 0.72
R9557:Fry UTSW 5 150466316 missense
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTTTAGGACTTGTATCCCAGGTAG -3'
(R):5'- AGGCTGTTTACCTGCACATC -3'

Sequencing Primer
(F):5'- CCCAGGTAGAAAATAATTGTACTGTG -3'
(R):5'- TGTTTACCTGCACATCAAACAAAGG -3'
Posted On 2019-05-15