Incidental Mutation 'R7108:Fry'
ID 551315
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene Name FRY microtubule binding protein
Synonyms cg003, 9330186A19Rik
MMRRC Submission 045200-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.460) question?
Stock # R7108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 150042110-150421218 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150319251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 972 (V972A)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087204
AA Change: V972A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: V972A

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,771,750 (GRCm39) S411P probably damaging Het
4930503L19Rik A T 18: 70,601,547 (GRCm39) Y112N probably benign Het
Abcd2 A T 15: 91,075,477 (GRCm39) V112E probably benign Het
Acadm A T 3: 153,631,437 (GRCm39) Y353* probably null Het
Adra2c A G 5: 35,437,342 (GRCm39) D38G probably benign Het
Ankrd10 C T 8: 11,662,624 (GRCm39) G370R probably damaging Het
Arfgef2 T A 2: 166,715,528 (GRCm39) N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,555,153 (GRCm39) T172A probably damaging Het
Bloc1s1 T A 10: 128,758,592 (GRCm39) K22M possibly damaging Het
Brpf3 A G 17: 29,036,099 (GRCm39) T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,344,741 (GRCm39) probably null Het
Ccdc186 T C 19: 56,787,192 (GRCm39) D592G probably damaging Het
Cfap161 A T 7: 83,442,518 (GRCm39) D98E possibly damaging Het
Cfi G A 3: 129,668,665 (GRCm39) V564M probably damaging Het
Cilp2 T A 8: 70,333,779 (GRCm39) Q1073L probably damaging Het
Cox6b1 A G 7: 30,322,929 (GRCm39) C40R possibly damaging Het
Cyp3a59 A T 5: 146,033,143 (GRCm39) M172L probably benign Het
Cyth1 T C 11: 118,073,739 (GRCm39) D198G probably damaging Het
Daam2 T C 17: 49,767,702 (GRCm39) D963G probably damaging Het
Ddi2 A T 4: 141,433,248 (GRCm39) D209E probably benign Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnai7 G A 6: 145,131,591 (GRCm39) Q351* probably null Het
Dpagt1 G T 9: 44,238,318 (GRCm39) probably benign Het
Drc3 T A 11: 60,261,380 (GRCm39) F177Y probably benign Het
Dsg2 T C 18: 20,734,920 (GRCm39) V966A probably damaging Het
E4f1 A G 17: 24,663,552 (GRCm39) V633A probably damaging Het
Eif2ak2 T A 17: 79,165,965 (GRCm39) R411* probably null Het
Frem2 T C 3: 53,560,934 (GRCm39) E1191G probably damaging Het
Fscn1 T C 5: 142,946,270 (GRCm39) Y23H probably damaging Het
Gm16506 T A 14: 43,961,759 (GRCm39) I163F Het
Gm21103 T C 14: 17,484,768 (GRCm39) Y92C probably damaging Het
Golgb1 A G 16: 36,734,083 (GRCm39) H1151R probably benign Het
Gprc5c T C 11: 114,755,108 (GRCm39) Y262H probably damaging Het
Hc G T 2: 34,929,706 (GRCm39) N245K probably benign Het
Hps6 T A 19: 45,993,929 (GRCm39) L622Q probably damaging Het
Hsd17b1 T C 11: 100,970,035 (GRCm39) Y156H probably damaging Het
Ireb2 T A 9: 54,813,925 (GRCm39) F799L probably damaging Het
Irf1 A G 11: 53,665,238 (GRCm39) D205G probably damaging Het
Kif12 A T 4: 63,089,442 (GRCm39) F103L probably benign Het
Krt12 C T 11: 99,306,878 (GRCm39) V475M unknown Het
Lca5 T A 9: 83,305,222 (GRCm39) T195S probably benign Het
Lrrc17 T C 5: 21,780,337 (GRCm39) V437A possibly damaging Het
Malt1 G T 18: 65,597,122 (GRCm39) D468Y probably damaging Het
Man2b2 C T 5: 36,972,829 (GRCm39) A562T probably benign Het
Mrc1 C T 2: 14,308,957 (GRCm39) Q794* probably null Het
Muc16 T A 9: 18,566,529 (GRCm39) I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Mycbp2 A T 14: 103,360,039 (GRCm39) F4518Y probably damaging Het
Myo5a T A 9: 75,037,274 (GRCm39) I159N probably damaging Het
Nat1 T C 8: 67,943,672 (GRCm39) V19A probably benign Het
Ndst4 A G 3: 125,355,120 (GRCm39) T343A probably damaging Het
Nlrp9b A T 7: 19,779,855 (GRCm39) L839F probably damaging Het
Nxnl1 A G 8: 72,019,198 (GRCm39) I9T probably benign Het
Odr4 T C 1: 150,258,041 (GRCm39) Y198C probably benign Het
Or1l4b C T 2: 37,036,272 (GRCm39) T16I probably benign Het
Or2ag12 G A 7: 106,277,255 (GRCm39) A146V probably benign Het
Or2t49 T A 11: 58,393,380 (GRCm39) M7L probably benign Het
Or52b4i A T 7: 102,191,199 (GRCm39) I19F probably damaging Het
Or7a35 C A 10: 78,853,483 (GRCm39) S109* probably null Het
Pou5f2 T C 13: 78,173,384 (GRCm39) S109P possibly damaging Het
Prkcz G A 4: 155,371,250 (GRCm39) Q321* probably null Het
Prr18 G T 17: 8,560,363 (GRCm39) R173L probably damaging Het
Ralgapb T C 2: 158,334,380 (GRCm39) Y1364H probably damaging Het
Ralgapb A T 2: 158,336,582 (GRCm39) I1407F probably damaging Het
Sacs T A 14: 61,448,458 (GRCm39) Y3501* probably null Het
Sall3 G A 18: 81,016,969 (GRCm39) P320S probably benign Het
Scn8a A T 15: 100,937,659 (GRCm39) H1676L probably benign Het
Shmt1 T C 11: 60,689,470 (GRCm39) D178G probably damaging Het
Slmap T C 14: 26,143,676 (GRCm39) K737R probably benign Het
Ssh2 G A 11: 77,345,620 (GRCm39) V1202I probably benign Het
Stard7 A G 2: 127,137,414 (GRCm39) D288G possibly damaging Het
Tek A T 4: 94,741,724 (GRCm39) D827V probably damaging Het
Tfap2e A G 4: 126,614,356 (GRCm39) L276P probably damaging Het
Tns3 T C 11: 8,387,251 (GRCm39) N1312S probably benign Het
Tubd1 T A 11: 86,448,631 (GRCm39) S315T probably damaging Het
Ube2f T A 1: 91,192,941 (GRCm39) C50* probably null Het
Vmn2r109 T C 17: 20,785,006 (GRCm39) I5V probably benign Het
Vmn2r39 T C 7: 9,026,667 (GRCm39) T445A probably damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150,263,869 (GRCm39) nonsense probably null
IGL00328:Fry APN 5 150,263,869 (GRCm39) nonsense probably null
IGL00841:Fry APN 5 150,346,189 (GRCm39) missense probably benign
IGL00938:Fry APN 5 150,293,645 (GRCm39) missense probably damaging 1.00
IGL01015:Fry APN 5 150,346,252 (GRCm39) missense probably benign 0.18
IGL01401:Fry APN 5 150,362,253 (GRCm39) missense probably benign
IGL01616:Fry APN 5 150,323,064 (GRCm39) missense probably damaging 1.00
IGL01616:Fry APN 5 150,362,276 (GRCm39) splice site probably null
IGL01748:Fry APN 5 150,269,116 (GRCm39) splice site probably benign
IGL01965:Fry APN 5 150,305,086 (GRCm39) missense probably damaging 1.00
IGL02030:Fry APN 5 150,395,083 (GRCm39) splice site probably benign
IGL02079:Fry APN 5 150,323,089 (GRCm39) missense probably damaging 0.97
IGL02087:Fry APN 5 150,327,059 (GRCm39) missense probably benign 0.23
IGL02113:Fry APN 5 150,323,070 (GRCm39) missense probably benign
IGL02209:Fry APN 5 150,360,491 (GRCm39) missense probably benign 0.00
IGL02250:Fry APN 5 150,326,899 (GRCm39) splice site probably benign
IGL02265:Fry APN 5 150,360,618 (GRCm39) missense probably damaging 1.00
IGL02486:Fry APN 5 150,414,642 (GRCm39) missense probably damaging 0.99
IGL02552:Fry APN 5 150,304,375 (GRCm39) missense probably damaging 1.00
IGL02881:Fry APN 5 150,282,516 (GRCm39) missense probably damaging 0.99
IGL03008:Fry APN 5 150,269,021 (GRCm39) missense possibly damaging 0.82
IGL03140:Fry APN 5 150,419,166 (GRCm39) missense probably damaging 0.98
IGL03171:Fry APN 5 150,304,274 (GRCm39) missense probably damaging 1.00
IGL03389:Fry APN 5 150,317,696 (GRCm39) missense probably damaging 1.00
IGL03404:Fry APN 5 150,249,633 (GRCm39) missense probably damaging 1.00
Brook UTSW 5 150,249,597 (GRCm39) missense probably damaging 1.00
haydn UTSW 5 150,341,929 (GRCm39) missense possibly damaging 0.94
miracle UTSW 5 150,360,624 (GRCm39) missense probably damaging 0.99
quickening UTSW 5 150,358,241 (GRCm39) missense probably damaging 1.00
seasons UTSW 5 150,389,902 (GRCm39) missense probably benign 0.06
Vivaldi UTSW 5 150,317,603 (GRCm39) missense possibly damaging 0.80
R0023:Fry UTSW 5 150,374,563 (GRCm39) missense possibly damaging 0.78
R0024:Fry UTSW 5 150,304,268 (GRCm39) missense probably benign 0.03
R0030:Fry UTSW 5 150,296,034 (GRCm39) nonsense probably null
R0053:Fry UTSW 5 150,384,842 (GRCm39) splice site probably benign
R0089:Fry UTSW 5 150,263,892 (GRCm39) missense possibly damaging 0.91
R0212:Fry UTSW 5 150,419,862 (GRCm39) missense probably damaging 0.99
R0241:Fry UTSW 5 150,183,811 (GRCm39) intron probably benign
R0265:Fry UTSW 5 150,358,241 (GRCm39) missense probably damaging 1.00
R0317:Fry UTSW 5 150,394,933 (GRCm39) missense probably damaging 1.00
R0532:Fry UTSW 5 150,402,226 (GRCm39) splice site probably benign
R0532:Fry UTSW 5 150,357,172 (GRCm39) unclassified probably benign
R0599:Fry UTSW 5 150,360,624 (GRCm39) missense probably damaging 0.99
R0631:Fry UTSW 5 150,419,817 (GRCm39) missense possibly damaging 0.82
R0723:Fry UTSW 5 150,419,825 (GRCm39) missense probably damaging 1.00
R0766:Fry UTSW 5 150,326,897 (GRCm39) splice site probably benign
R0790:Fry UTSW 5 150,389,902 (GRCm39) missense probably benign 0.06
R0928:Fry UTSW 5 150,360,549 (GRCm39) missense probably damaging 1.00
R1104:Fry UTSW 5 150,419,754 (GRCm39) missense probably damaging 1.00
R1144:Fry UTSW 5 150,341,929 (GRCm39) missense possibly damaging 0.94
R1172:Fry UTSW 5 150,404,959 (GRCm39) nonsense probably null
R1312:Fry UTSW 5 150,326,897 (GRCm39) splice site probably benign
R1347:Fry UTSW 5 150,419,283 (GRCm39) missense probably damaging 1.00
R1347:Fry UTSW 5 150,419,283 (GRCm39) missense probably damaging 1.00
R1437:Fry UTSW 5 150,233,890 (GRCm39) missense possibly damaging 0.92
R1458:Fry UTSW 5 150,304,324 (GRCm39) missense probably damaging 1.00
R1542:Fry UTSW 5 150,328,431 (GRCm39) missense probably benign 0.13
R1692:Fry UTSW 5 150,293,692 (GRCm39) missense probably damaging 1.00
R1826:Fry UTSW 5 150,360,174 (GRCm39) missense possibly damaging 0.82
R1874:Fry UTSW 5 150,269,386 (GRCm39) missense probably damaging 1.00
R1875:Fry UTSW 5 150,249,597 (GRCm39) missense probably damaging 1.00
R1881:Fry UTSW 5 150,401,511 (GRCm39) missense probably damaging 0.97
R1884:Fry UTSW 5 150,326,985 (GRCm39) missense probably benign 0.00
R1929:Fry UTSW 5 150,324,389 (GRCm39) missense probably null 0.02
R2066:Fry UTSW 5 150,293,584 (GRCm39) splice site probably benign
R2270:Fry UTSW 5 150,324,389 (GRCm39) missense probably null 0.02
R2356:Fry UTSW 5 150,394,897 (GRCm39) missense probably benign
R3720:Fry UTSW 5 150,378,037 (GRCm39) missense probably damaging 1.00
R3773:Fry UTSW 5 150,321,663 (GRCm39) missense probably damaging 0.96
R3824:Fry UTSW 5 150,419,884 (GRCm39) missense possibly damaging 0.94
R3902:Fry UTSW 5 150,269,392 (GRCm39) missense probably damaging 1.00
R3923:Fry UTSW 5 150,336,814 (GRCm39) missense probably benign
R4250:Fry UTSW 5 150,233,825 (GRCm39) missense probably damaging 0.99
R4332:Fry UTSW 5 150,305,128 (GRCm39) missense probably damaging 1.00
R4495:Fry UTSW 5 150,233,928 (GRCm39) missense probably damaging 1.00
R4610:Fry UTSW 5 150,309,569 (GRCm39) missense probably damaging 1.00
R4682:Fry UTSW 5 150,346,219 (GRCm39) missense probably damaging 1.00
R4732:Fry UTSW 5 150,309,472 (GRCm39) missense
R4733:Fry UTSW 5 150,309,472 (GRCm39) missense
R4755:Fry UTSW 5 150,321,719 (GRCm39) missense probably damaging 0.99
R4788:Fry UTSW 5 150,323,101 (GRCm39) missense probably benign 0.00
R4803:Fry UTSW 5 150,322,998 (GRCm39) missense probably benign 0.31
R4858:Fry UTSW 5 150,325,108 (GRCm39) missense possibly damaging 0.78
R4872:Fry UTSW 5 150,317,704 (GRCm39) critical splice donor site probably null
R4902:Fry UTSW 5 150,419,168 (GRCm39) missense probably benign 0.43
R4915:Fry UTSW 5 150,402,328 (GRCm39) missense probably benign 0.30
R4938:Fry UTSW 5 150,401,454 (GRCm39) missense probably damaging 1.00
R4983:Fry UTSW 5 150,321,719 (GRCm39) missense probably damaging 1.00
R5004:Fry UTSW 5 150,357,069 (GRCm39) missense probably benign 0.16
R5040:Fry UTSW 5 150,312,319 (GRCm39) missense probably damaging 0.99
R5145:Fry UTSW 5 150,293,689 (GRCm39) missense probably damaging 0.98
R5170:Fry UTSW 5 150,353,319 (GRCm39) missense probably benign 0.03
R5233:Fry UTSW 5 150,393,185 (GRCm39) missense possibly damaging 0.71
R5428:Fry UTSW 5 150,328,824 (GRCm39) missense possibly damaging 0.89
R5468:Fry UTSW 5 150,323,053 (GRCm39) missense probably benign 0.44
R5481:Fry UTSW 5 150,183,784 (GRCm39) missense probably benign 0.01
R5494:Fry UTSW 5 150,314,132 (GRCm39) missense probably damaging 1.00
R5538:Fry UTSW 5 150,419,313 (GRCm39) missense probably damaging 1.00
R5638:Fry UTSW 5 150,282,546 (GRCm39) missense possibly damaging 0.46
R5645:Fry UTSW 5 150,304,332 (GRCm39) missense probably damaging 1.00
R5716:Fry UTSW 5 150,293,686 (GRCm39) nonsense probably null
R5812:Fry UTSW 5 150,323,136 (GRCm39) missense probably damaging 0.99
R5813:Fry UTSW 5 150,323,136 (GRCm39) missense probably damaging 0.99
R5873:Fry UTSW 5 150,302,350 (GRCm39) missense probably damaging 1.00
R5933:Fry UTSW 5 150,314,265 (GRCm39) intron probably benign
R6037:Fry UTSW 5 150,351,644 (GRCm39) missense probably benign 0.03
R6037:Fry UTSW 5 150,351,644 (GRCm39) missense probably benign 0.03
R6158:Fry UTSW 5 150,378,037 (GRCm39) missense probably damaging 1.00
R6178:Fry UTSW 5 150,377,987 (GRCm39) missense probably damaging 1.00
R6481:Fry UTSW 5 150,309,479 (GRCm39) missense probably damaging 1.00
R6562:Fry UTSW 5 150,249,614 (GRCm39) missense probably damaging 1.00
R6676:Fry UTSW 5 150,304,387 (GRCm39) missense probably benign 0.22
R6717:Fry UTSW 5 150,419,777 (GRCm39) missense probably benign 0.00
R6828:Fry UTSW 5 150,389,911 (GRCm39) splice site probably null
R6874:Fry UTSW 5 150,360,768 (GRCm39) missense probably benign 0.00
R6930:Fry UTSW 5 150,351,695 (GRCm39) missense probably benign 0.00
R6963:Fry UTSW 5 150,381,309 (GRCm39) missense probably benign 0.17
R6965:Fry UTSW 5 150,339,685 (GRCm39) missense possibly damaging 0.79
R7051:Fry UTSW 5 150,318,634 (GRCm39) missense possibly damaging 0.93
R7085:Fry UTSW 5 150,362,214 (GRCm39) missense probably benign 0.02
R7108:Fry UTSW 5 150,414,555 (GRCm39) missense
R7115:Fry UTSW 5 150,309,532 (GRCm39) missense probably damaging 1.00
R7116:Fry UTSW 5 150,319,334 (GRCm39) critical splice donor site probably null
R7197:Fry UTSW 5 150,393,232 (GRCm39) missense
R7256:Fry UTSW 5 150,390,251 (GRCm39) missense
R7318:Fry UTSW 5 150,360,458 (GRCm39) missense probably damaging 0.98
R7323:Fry UTSW 5 150,419,814 (GRCm39) missense
R7358:Fry UTSW 5 150,339,788 (GRCm39) missense probably benign
R7361:Fry UTSW 5 150,360,312 (GRCm39) missense possibly damaging 0.92
R7395:Fry UTSW 5 150,304,348 (GRCm39) missense possibly damaging 0.82
R7487:Fry UTSW 5 150,338,039 (GRCm39) missense possibly damaging 0.79
R7491:Fry UTSW 5 150,389,791 (GRCm39) missense
R7574:Fry UTSW 5 150,304,359 (GRCm39) missense probably benign 0.00
R7582:Fry UTSW 5 150,419,847 (GRCm39) missense
R7586:Fry UTSW 5 150,349,683 (GRCm39) missense probably damaging 1.00
R7650:Fry UTSW 5 150,336,883 (GRCm39) missense probably damaging 1.00
R7699:Fry UTSW 5 150,328,792 (GRCm39) missense probably damaging 0.98
R7700:Fry UTSW 5 150,328,792 (GRCm39) missense probably damaging 0.98
R7972:Fry UTSW 5 150,233,861 (GRCm39) missense probably benign 0.05
R8058:Fry UTSW 5 150,419,232 (GRCm39) missense
R8070:Fry UTSW 5 150,401,472 (GRCm39) missense
R8159:Fry UTSW 5 150,322,998 (GRCm39) missense probably benign 0.31
R8202:Fry UTSW 5 150,355,202 (GRCm39) missense probably damaging 1.00
R8261:Fry UTSW 5 150,369,372 (GRCm39) missense probably damaging 1.00
R8279:Fry UTSW 5 150,419,726 (GRCm39) missense
R8338:Fry UTSW 5 150,282,516 (GRCm39) missense probably damaging 0.99
R8370:Fry UTSW 5 150,319,284 (GRCm39) missense probably damaging 1.00
R8673:Fry UTSW 5 150,318,576 (GRCm39) missense possibly damaging 0.91
R8786:Fry UTSW 5 150,317,501 (GRCm39) missense probably benign 0.00
R8815:Fry UTSW 5 150,317,603 (GRCm39) missense possibly damaging 0.80
R8847:Fry UTSW 5 150,309,472 (GRCm39) missense
R9023:Fry UTSW 5 150,360,768 (GRCm39) missense probably benign 0.00
R9025:Fry UTSW 5 150,219,273 (GRCm39) intron probably benign
R9125:Fry UTSW 5 150,269,525 (GRCm39) missense probably damaging 0.97
R9172:Fry UTSW 5 150,336,793 (GRCm39) missense probably benign
R9262:Fry UTSW 5 150,305,109 (GRCm39) missense probably damaging 1.00
R9263:Fry UTSW 5 150,322,728 (GRCm39) missense probably damaging 1.00
R9293:Fry UTSW 5 150,419,297 (GRCm39) missense
R9368:Fry UTSW 5 150,401,403 (GRCm39) missense
R9401:Fry UTSW 5 150,302,403 (GRCm39) missense probably damaging 1.00
R9402:Fry UTSW 5 150,360,318 (GRCm39) missense probably damaging 1.00
R9402:Fry UTSW 5 150,357,161 (GRCm39) missense possibly damaging 0.91
R9420:Fry UTSW 5 150,356,994 (GRCm39) missense possibly damaging 0.72
R9557:Fry UTSW 5 150,389,781 (GRCm39) missense
R9647:Fry UTSW 5 150,292,984 (GRCm39) missense probably damaging 1.00
R9650:Fry UTSW 5 150,369,375 (GRCm39) missense probably damaging 1.00
R9655:Fry UTSW 5 150,362,251 (GRCm39) missense possibly damaging 0.90
R9664:Fry UTSW 5 150,282,488 (GRCm39) missense probably damaging 0.98
R9668:Fry UTSW 5 150,282,318 (GRCm39) missense probably damaging 1.00
R9732:Fry UTSW 5 150,328,758 (GRCm39) missense probably benign 0.00
R9773:Fry UTSW 5 150,322,728 (GRCm39) missense probably damaging 1.00
Z1177:Fry UTSW 5 150,233,902 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTTTAGGACTTGTATCCCAGGTAG -3'
(R):5'- AGGCTGTTTACCTGCACATC -3'

Sequencing Primer
(F):5'- CCCAGGTAGAAAATAATTGTACTGTG -3'
(R):5'- TGTTTACCTGCACATCAAACAAAGG -3'
Posted On 2019-05-15