Incidental Mutation 'R7108:E430018J23Rik'
ID551324
Institutional Source Beutler Lab
Gene Symbol E430018J23Rik
Ensembl Gene ENSMUSG00000078580
Gene NameRIKEN cDNA E430018J23 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127389673-127393629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127391523 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 431 (S431P)
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000164345] [ENSMUST00000165495]
Predicted Effect probably benign
Transcript: ENSMUST00000049052
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074249
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106303
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
AA Change: S431P

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: S431P

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in E430018J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:E430018J23Rik APN 7 127392036 missense possibly damaging 0.92
IGL01782:E430018J23Rik APN 7 127393304 missense probably benign 0.02
IGL02174:E430018J23Rik APN 7 127392353 missense possibly damaging 0.54
IGL02882:E430018J23Rik APN 7 127392252 missense probably damaging 1.00
IGL03152:E430018J23Rik APN 7 127392297 missense probably damaging 1.00
R0552:E430018J23Rik UTSW 7 127392332 missense possibly damaging 0.92
R1828:E430018J23Rik UTSW 7 127391909 missense probably damaging 1.00
R1843:E430018J23Rik UTSW 7 127391488 missense probably benign 0.32
R1866:E430018J23Rik UTSW 7 127393331 missense probably damaging 1.00
R3429:E430018J23Rik UTSW 7 127391742 missense possibly damaging 0.79
R4433:E430018J23Rik UTSW 7 127393002 missense possibly damaging 0.75
R4933:E430018J23Rik UTSW 7 127393349 missense probably damaging 1.00
R5292:E430018J23Rik UTSW 7 127392487 missense possibly damaging 0.48
R6218:E430018J23Rik UTSW 7 127393409 missense possibly damaging 0.85
R6667:E430018J23Rik UTSW 7 127393423 missense probably benign 0.35
R6712:E430018J23Rik UTSW 7 127392310 missense probably damaging 1.00
R7214:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7215:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7216:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7313:E430018J23Rik UTSW 7 127391684 missense probably benign 0.23
R7396:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7397:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7398:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7478:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7479:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7480:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7481:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7512:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7652:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7716:E430018J23Rik UTSW 7 127392087 missense probably benign
R7820:E430018J23Rik UTSW 7 127391436 missense possibly damaging 0.84
R7999:E430018J23Rik UTSW 7 127392428 missense probably damaging 0.98
X0022:E430018J23Rik UTSW 7 127393270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACCAGCAGTACCTAGAATG -3'
(R):5'- CTTATTCATGCCCTGACTGTGG -3'

Sequencing Primer
(F):5'- CCAGCAGTACCTAGAATGTCTGTG -3'
(R):5'- TGGACGCTGCTTTCGACAGAG -3'
Posted On2019-05-15