Incidental Mutation 'R7108:Muc16'
ID551331
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18655233 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1997 (I1997L)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: I1997L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- GTAGTCACCCATACAGAGGGAG -3'
(R):5'- AGACTCTTTCGGCAGATAGTACTG -3'

Sequencing Primer
(F):5'- TCAGCGTCTCTAGATGACTCAGAG -3'
(R):5'- AGATAGTACTGCCTCTTCCTTGTTG -3'
Posted On2019-05-15