Incidental Mutation 'R7108:Olfr1351'
ID551336
Institutional Source Beutler Lab
Gene Symbol Olfr1351
Ensembl Gene ENSMUSG00000063216
Gene Nameolfactory receptor 1351
SynonymsMOR139-4, GA_x6K02T2QGN0-2794907-2793948
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79012472-79019645 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 79017649 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 109 (S109*)
Ref Sequence ENSEMBL: ENSMUSP00000149241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080730] [ENSMUST00000216030]
Predicted Effect probably null
Transcript: ENSMUST00000080730
AA Change: S109*
SMART Domains Protein: ENSMUSP00000079555
Gene: ENSMUSG00000063216
AA Change: S109*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216030
AA Change: S109*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Olfr1351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr1351 APN 10 79018251 missense probably benign 0.00
IGL01833:Olfr1351 APN 10 79017936 missense probably benign
IGL02141:Olfr1351 APN 10 79017721 missense probably damaging 1.00
IGL02178:Olfr1351 APN 10 79017720 missense possibly damaging 0.59
R1070:Olfr1351 UTSW 10 79017850 missense probably damaging 0.99
R1631:Olfr1351 UTSW 10 79017405 missense probably benign 0.00
R1646:Olfr1351 UTSW 10 79017506 nonsense probably null
R1781:Olfr1351 UTSW 10 79017325 start codon destroyed probably null 0.89
R2358:Olfr1351 UTSW 10 79018188 missense probably damaging 1.00
R3161:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R5874:Olfr1351 UTSW 10 79017357 missense possibly damaging 0.95
R6382:Olfr1351 UTSW 10 79017517 missense probably damaging 1.00
R7567:Olfr1351 UTSW 10 79017545 missense probably benign 0.04
R7568:Olfr1351 UTSW 10 79017507 missense probably benign
R7915:Olfr1351 UTSW 10 79017430 missense probably damaging 1.00
R7936:Olfr1351 UTSW 10 79018038 missense probably damaging 1.00
Z1176:Olfr1351 UTSW 10 79018205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCATGGCCATCACTGC -3'
(R):5'- AAAAGTGAGGGATCTCCAGGTC -3'

Sequencing Primer
(F):5'- ATGGCCATCACTGCCGACTC -3'
(R):5'- ATCTCCAGGTCTGTGCAGAATGAC -3'
Posted On2019-05-15