Incidental Mutation 'R0597:Med1'
Institutional Source Beutler Lab
Gene Symbol Med1
Ensembl Gene ENSMUSG00000018160
Gene Namemediator complex subunit 1
SynonymsPparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosomal Location98152154-98193293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98169438 bp
Amino Acid Change Methionine to Valine at position 222 (M222V)
Ref Sequence ENSEMBL: ENSMUSP00000103169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]
Predicted Effect probably benign
Transcript: ENSMUST00000018304
AA Change: M207V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: M207V

Pfam:Med1 18 414 3.7e-112 PFAM
low complexity region 536 559 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 667 678 N/A INTRINSIC
low complexity region 960 981 N/A INTRINSIC
low complexity region 989 999 N/A INTRINSIC
low complexity region 1015 1036 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1063 1138 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1205 1243 N/A INTRINSIC
low complexity region 1250 1281 N/A INTRINSIC
low complexity region 1344 1364 N/A INTRINSIC
low complexity region 1482 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092735
AA Change: M222V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160
AA Change: M222V

Pfam:Med1 33 429 1.2e-113 PFAM
transmembrane domain 585 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107545
AA Change: M222V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: M222V

Pfam:Med1 59 426 2.9e-74 PFAM
low complexity region 551 574 N/A INTRINSIC
low complexity region 610 634 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 975 996 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
low complexity region 1030 1051 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1078 1153 N/A INTRINSIC
low complexity region 1185 1198 N/A INTRINSIC
low complexity region 1220 1258 N/A INTRINSIC
low complexity region 1265 1296 N/A INTRINSIC
low complexity region 1359 1379 N/A INTRINSIC
low complexity region 1497 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135479
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Med1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med1 APN 11 98155684 intron probably benign
IGL00690:Med1 APN 11 98169400 missense possibly damaging 0.94
IGL01087:Med1 APN 11 98180285 missense probably damaging 1.00
IGL01133:Med1 APN 11 98157986 nonsense probably null
IGL02223:Med1 APN 11 98157876 missense probably damaging 1.00
IGL02257:Med1 APN 11 98180270 missense probably damaging 0.98
IGL02699:Med1 APN 11 98180025 missense possibly damaging 0.61
IGL02706:Med1 APN 11 98156707 intron probably benign
IGL02902:Med1 APN 11 98156509 intron probably benign
IGL02986:Med1 APN 11 98156260 intron probably benign
IGL03011:Med1 APN 11 98161033 missense possibly damaging 0.92
IGL03282:Med1 APN 11 98156817 missense probably damaging 1.00
IGL03303:Med1 APN 11 98158352 missense probably damaging 1.00
IGL03342:Med1 APN 11 98189180 critical splice donor site probably null
IGL03410:Med1 APN 11 98189183 missense possibly damaging 0.62
PIT4453001:Med1 UTSW 11 98158417 missense probably benign 0.40
R0040:Med1 UTSW 11 98166255 critical splice donor site probably null
R0206:Med1 UTSW 11 98155689 intron probably benign
R0206:Med1 UTSW 11 98155689 intron probably benign
R0208:Med1 UTSW 11 98155689 intron probably benign
R0310:Med1 UTSW 11 98167574 missense probably benign 0.38
R0505:Med1 UTSW 11 98156904 missense probably damaging 1.00
R0680:Med1 UTSW 11 98180166 splice site probably null
R0686:Med1 UTSW 11 98158404 missense probably damaging 1.00
R0698:Med1 UTSW 11 98155689 intron probably benign
R1293:Med1 UTSW 11 98157036 missense possibly damaging 0.93
R1302:Med1 UTSW 11 98157449 missense possibly damaging 0.50
R1365:Med1 UTSW 11 98155995 intron probably benign
R1537:Med1 UTSW 11 98160946 missense probably damaging 0.97
R1609:Med1 UTSW 11 98161170 missense possibly damaging 0.91
R1631:Med1 UTSW 11 98155626 intron probably benign
R1792:Med1 UTSW 11 98157283 missense probably damaging 1.00
R1831:Med1 UTSW 11 98156611 intron probably benign
R1837:Med1 UTSW 11 98169412 missense probably damaging 1.00
R2366:Med1 UTSW 11 98161182 missense probably damaging 0.98
R3754:Med1 UTSW 11 98166722 missense possibly damaging 0.77
R3762:Med1 UTSW 11 98155515 intron probably benign
R4012:Med1 UTSW 11 98171706 missense possibly damaging 0.85
R4112:Med1 UTSW 11 98180087 missense probably damaging 1.00
R4384:Med1 UTSW 11 98152862 unclassified probably benign
R4579:Med1 UTSW 11 98158422 missense possibly damaging 0.56
R4740:Med1 UTSW 11 98180264 nonsense probably null
R4819:Med1 UTSW 11 98155432 intron probably benign
R4879:Med1 UTSW 11 98155360 unclassified probably benign
R4993:Med1 UTSW 11 98163904 missense probably damaging 1.00
R5040:Med1 UTSW 11 98155404 intron probably benign
R5249:Med1 UTSW 11 98157240 missense probably benign 0.43
R5373:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5374:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5552:Med1 UTSW 11 98166331 nonsense probably null
R5692:Med1 UTSW 11 98156380 intron probably benign
R6010:Med1 UTSW 11 98158362 missense probably damaging 1.00
R6149:Med1 UTSW 11 98183853 missense possibly damaging 0.74
R6417:Med1 UTSW 11 98157228 missense probably damaging 0.97
R7301:Med1 UTSW 11 98152808 missense probably benign 0.23
R7507:Med1 UTSW 11 98158026 missense probably damaging 1.00
R7529:Med1 UTSW 11 98155965 missense unknown
R7588:Med1 UTSW 11 98155572 missense unknown
R7654:Med1 UTSW 11 98169363 missense possibly damaging 0.75
R7662:Med1 UTSW 11 98155392 missense unknown
R7679:Med1 UTSW 11 98156061 missense unknown
R7862:Med1 UTSW 11 98161210 missense probably benign 0.05
R8447:Med1 UTSW 11 98169414 missense probably damaging 1.00
R8693:Med1 UTSW 11 98155773 missense not run
Z1176:Med1 UTSW 11 98161183 missense possibly damaging 0.62
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agttcttggaaggctgaagtg -3'
Posted On2013-07-11