Incidental Mutation 'R0597:Hif1a'
ID55136
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Namehypoxia inducible factor 1, alpha subunit
SynonymsbHLHe78, HIF1alpha, MOP1, HIF-1alpha
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73901375-73947530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73942275 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 645 (S645R)
Ref Sequence ENSEMBL: ENSMUSP00000106088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461]
Predicted Effect probably benign
Transcript: ENSMUST00000021530
AA Change: S671R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: S671R

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110461
AA Change: S645R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: S645R

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73942010 missense probably damaging 1.00
IGL01396:Hif1a APN 12 73940533 missense probably benign 0.00
IGL02230:Hif1a APN 12 73932450 missense probably damaging 1.00
IGL02561:Hif1a APN 12 73942206 missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73930771 critical splice donor site probably null
IGL03027:Hif1a APN 12 73940477 missense probably benign 0.03
lightweight UTSW 12 73941800 missense probably damaging 1.00
R0614:Hif1a UTSW 12 73945631 missense probably damaging 1.00
R0678:Hif1a UTSW 12 73944191 splice site probably null
R0967:Hif1a UTSW 12 73937670 missense possibly damaging 0.91
R1351:Hif1a UTSW 12 73940461 missense probably benign 0.00
R1387:Hif1a UTSW 12 73942292 missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73944155 missense probably benign
R2105:Hif1a UTSW 12 73937745 missense probably damaging 1.00
R2194:Hif1a UTSW 12 73930747 missense probably damaging 0.98
R4825:Hif1a UTSW 12 73932401 missense probably damaging 1.00
R4924:Hif1a UTSW 12 73939557 missense probably damaging 1.00
R5386:Hif1a UTSW 12 73944093 missense probably benign 0.02
R5594:Hif1a UTSW 12 73937792 nonsense probably null
R5722:Hif1a UTSW 12 73941759 missense probably benign 0.00
R5818:Hif1a UTSW 12 73939564 missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73942144 missense probably benign
R6026:Hif1a UTSW 12 73932281 missense probably damaging 1.00
R6059:Hif1a UTSW 12 73941800 missense probably damaging 1.00
R6084:Hif1a UTSW 12 73941842 missense probably damaging 0.99
R6818:Hif1a UTSW 12 73945563 nonsense probably null
R6878:Hif1a UTSW 12 73928281 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CACAGTTACTGGGTTCCAGCAGAC -3'
(R):5'- AGCAGCATGAAGAGATTCCTGGC -3'

Sequencing Primer
(F):5'- GGTTCCAGCAGACCCAGTTAC -3'
(R):5'- GTTGGAAAACATCTCTGACCTC -3'
Posted On2013-07-11