Incidental Mutation 'R7108:4930503L19Rik'
ID551368
Institutional Source Beutler Lab
Gene Symbol 4930503L19Rik
Ensembl Gene ENSMUSG00000044906
Gene NameRIKEN cDNA 4930503L19 gene
SynonymsLas2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location70452212-70472509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70468476 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 112 (Y112N)
Ref Sequence ENSEMBL: ENSMUSP00000065118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067556] [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667] [ENSMUST00000211817] [ENSMUST00000212074] [ENSMUST00000212155] [ENSMUST00000212539] [ENSMUST00000212683] [ENSMUST00000212982]
Predicted Effect probably benign
Transcript: ENSMUST00000067556
AA Change: Y112N

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065118
Gene: ENSMUSG00000044906
AA Change: Y112N

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:LAS2 161 235 2.8e-26 PFAM
Pfam:LAS2 325 387 9.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114959
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164223
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168249
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174118
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211817
Predicted Effect possibly damaging
Transcript: ENSMUST00000212074
AA Change: Y97N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212155
AA Change: Y112N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212539
AA Change: Y112N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212683
AA Change: Y112N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212982
AA Change: Y112N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in 4930503L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:4930503L19Rik APN 18 70453333 nonsense probably null
IGL01549:4930503L19Rik APN 18 70468035 missense possibly damaging 0.46
R0119:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0299:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0554:4930503L19Rik UTSW 18 70467380 missense probably damaging 1.00
R0657:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0973:4930503L19Rik UTSW 18 70467926 unclassified probably null
R0973:4930503L19Rik UTSW 18 70467926 unclassified probably null
R0974:4930503L19Rik UTSW 18 70467926 unclassified probably null
R1710:4930503L19Rik UTSW 18 70468063 missense possibly damaging 0.83
R2046:4930503L19Rik UTSW 18 70467482 missense probably damaging 1.00
R2361:4930503L19Rik UTSW 18 70469575 missense probably damaging 1.00
R2936:4930503L19Rik UTSW 18 70468448 missense probably damaging 0.98
R5266:4930503L19Rik UTSW 18 70458384 missense probably damaging 1.00
R6317:4930503L19Rik UTSW 18 70468193 missense probably damaging 1.00
R6381:4930503L19Rik UTSW 18 70467717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCTTGGAAGTAGCGTC -3'
(R):5'- AAGAAGCTTGTGTTCTGTGTATCAG -3'

Sequencing Primer
(F):5'- GTAGCGTCTACATAAAAACTTGGAC -3'
(R):5'- GCTTGTGTTCTGTGTATCAGTTTATG -3'
Posted On2019-05-15