Incidental Mutation 'R7108:Sall3'
ID 551369
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Name spalt like transcription factor 3
Synonyms Salt, B130022O04Rik, Spalt, Msal, Msal-1
MMRRC Submission 045200-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 81010204-81030236 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81016969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 320 (P320S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: P320S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: P320S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,771,750 (GRCm39) S411P probably damaging Het
4930503L19Rik A T 18: 70,601,547 (GRCm39) Y112N probably benign Het
Abcd2 A T 15: 91,075,477 (GRCm39) V112E probably benign Het
Acadm A T 3: 153,631,437 (GRCm39) Y353* probably null Het
Adra2c A G 5: 35,437,342 (GRCm39) D38G probably benign Het
Ankrd10 C T 8: 11,662,624 (GRCm39) G370R probably damaging Het
Arfgef2 T A 2: 166,715,528 (GRCm39) N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,555,153 (GRCm39) T172A probably damaging Het
Bloc1s1 T A 10: 128,758,592 (GRCm39) K22M possibly damaging Het
Brpf3 A G 17: 29,036,099 (GRCm39) T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,344,741 (GRCm39) probably null Het
Ccdc186 T C 19: 56,787,192 (GRCm39) D592G probably damaging Het
Cfap161 A T 7: 83,442,518 (GRCm39) D98E possibly damaging Het
Cfi G A 3: 129,668,665 (GRCm39) V564M probably damaging Het
Cilp2 T A 8: 70,333,779 (GRCm39) Q1073L probably damaging Het
Cox6b1 A G 7: 30,322,929 (GRCm39) C40R possibly damaging Het
Cyp3a59 A T 5: 146,033,143 (GRCm39) M172L probably benign Het
Cyth1 T C 11: 118,073,739 (GRCm39) D198G probably damaging Het
Daam2 T C 17: 49,767,702 (GRCm39) D963G probably damaging Het
Ddi2 A T 4: 141,433,248 (GRCm39) D209E probably benign Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnai7 G A 6: 145,131,591 (GRCm39) Q351* probably null Het
Dpagt1 G T 9: 44,238,318 (GRCm39) probably benign Het
Drc3 T A 11: 60,261,380 (GRCm39) F177Y probably benign Het
Dsg2 T C 18: 20,734,920 (GRCm39) V966A probably damaging Het
E4f1 A G 17: 24,663,552 (GRCm39) V633A probably damaging Het
Eif2ak2 T A 17: 79,165,965 (GRCm39) R411* probably null Het
Frem2 T C 3: 53,560,934 (GRCm39) E1191G probably damaging Het
Fry T C 5: 150,319,251 (GRCm39) V972A probably damaging Het
Fry T A 5: 150,414,555 (GRCm39) C467S Het
Fscn1 T C 5: 142,946,270 (GRCm39) Y23H probably damaging Het
Gm16506 T A 14: 43,961,759 (GRCm39) I163F Het
Gm21103 T C 14: 17,484,768 (GRCm39) Y92C probably damaging Het
Golgb1 A G 16: 36,734,083 (GRCm39) H1151R probably benign Het
Gprc5c T C 11: 114,755,108 (GRCm39) Y262H probably damaging Het
Hc G T 2: 34,929,706 (GRCm39) N245K probably benign Het
Hps6 T A 19: 45,993,929 (GRCm39) L622Q probably damaging Het
Hsd17b1 T C 11: 100,970,035 (GRCm39) Y156H probably damaging Het
Ireb2 T A 9: 54,813,925 (GRCm39) F799L probably damaging Het
Irf1 A G 11: 53,665,238 (GRCm39) D205G probably damaging Het
Kif12 A T 4: 63,089,442 (GRCm39) F103L probably benign Het
Krt12 C T 11: 99,306,878 (GRCm39) V475M unknown Het
Lca5 T A 9: 83,305,222 (GRCm39) T195S probably benign Het
Lrrc17 T C 5: 21,780,337 (GRCm39) V437A possibly damaging Het
Malt1 G T 18: 65,597,122 (GRCm39) D468Y probably damaging Het
Man2b2 C T 5: 36,972,829 (GRCm39) A562T probably benign Het
Mrc1 C T 2: 14,308,957 (GRCm39) Q794* probably null Het
Muc16 T A 9: 18,566,529 (GRCm39) I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Mycbp2 A T 14: 103,360,039 (GRCm39) F4518Y probably damaging Het
Myo5a T A 9: 75,037,274 (GRCm39) I159N probably damaging Het
Nat1 T C 8: 67,943,672 (GRCm39) V19A probably benign Het
Ndst4 A G 3: 125,355,120 (GRCm39) T343A probably damaging Het
Nlrp9b A T 7: 19,779,855 (GRCm39) L839F probably damaging Het
Nxnl1 A G 8: 72,019,198 (GRCm39) I9T probably benign Het
Odr4 T C 1: 150,258,041 (GRCm39) Y198C probably benign Het
Or1l4b C T 2: 37,036,272 (GRCm39) T16I probably benign Het
Or2ag12 G A 7: 106,277,255 (GRCm39) A146V probably benign Het
Or2t49 T A 11: 58,393,380 (GRCm39) M7L probably benign Het
Or52b4i A T 7: 102,191,199 (GRCm39) I19F probably damaging Het
Or7a35 C A 10: 78,853,483 (GRCm39) S109* probably null Het
Pou5f2 T C 13: 78,173,384 (GRCm39) S109P possibly damaging Het
Prkcz G A 4: 155,371,250 (GRCm39) Q321* probably null Het
Prr18 G T 17: 8,560,363 (GRCm39) R173L probably damaging Het
Ralgapb T C 2: 158,334,380 (GRCm39) Y1364H probably damaging Het
Ralgapb A T 2: 158,336,582 (GRCm39) I1407F probably damaging Het
Sacs T A 14: 61,448,458 (GRCm39) Y3501* probably null Het
Scn8a A T 15: 100,937,659 (GRCm39) H1676L probably benign Het
Shmt1 T C 11: 60,689,470 (GRCm39) D178G probably damaging Het
Slmap T C 14: 26,143,676 (GRCm39) K737R probably benign Het
Ssh2 G A 11: 77,345,620 (GRCm39) V1202I probably benign Het
Stard7 A G 2: 127,137,414 (GRCm39) D288G possibly damaging Het
Tek A T 4: 94,741,724 (GRCm39) D827V probably damaging Het
Tfap2e A G 4: 126,614,356 (GRCm39) L276P probably damaging Het
Tns3 T C 11: 8,387,251 (GRCm39) N1312S probably benign Het
Tubd1 T A 11: 86,448,631 (GRCm39) S315T probably damaging Het
Ube2f T A 1: 91,192,941 (GRCm39) C50* probably null Het
Vmn2r109 T C 17: 20,785,006 (GRCm39) I5V probably benign Het
Vmn2r39 T C 7: 9,026,667 (GRCm39) T445A probably damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 81,016,447 (GRCm39) missense probably damaging 0.98
IGL01630:Sall3 APN 18 81,014,484 (GRCm39) missense probably benign 0.03
IGL01713:Sall3 APN 18 81,013,062 (GRCm39) missense probably damaging 1.00
IGL01803:Sall3 APN 18 81,013,047 (GRCm39) missense possibly damaging 0.65
IGL02627:Sall3 APN 18 81,015,576 (GRCm39) missense possibly damaging 0.86
IGL02858:Sall3 APN 18 81,012,728 (GRCm39) missense probably damaging 1.00
IGL03177:Sall3 APN 18 81,016,183 (GRCm39) missense probably benign 0.00
fountain UTSW 18 81,017,691 (GRCm39) missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 81,016,665 (GRCm39) missense probably benign 0.01
R1055:Sall3 UTSW 18 81,013,007 (GRCm39) missense probably benign 0.24
R1258:Sall3 UTSW 18 81,017,280 (GRCm39) missense probably damaging 1.00
R1932:Sall3 UTSW 18 81,012,968 (GRCm39) missense probably benign 0.44
R1976:Sall3 UTSW 18 81,015,108 (GRCm39) missense probably benign 0.42
R2124:Sall3 UTSW 18 81,015,012 (GRCm39) missense probably benign 0.01
R2142:Sall3 UTSW 18 81,013,046 (GRCm39) missense probably damaging 0.98
R2199:Sall3 UTSW 18 81,015,085 (GRCm39) missense probably benign 0.27
R2365:Sall3 UTSW 18 81,015,007 (GRCm39) missense probably benign 0.01
R3856:Sall3 UTSW 18 81,015,717 (GRCm39) missense probably damaging 1.00
R4022:Sall3 UTSW 18 81,013,055 (GRCm39) missense probably benign 0.05
R4050:Sall3 UTSW 18 81,014,697 (GRCm39) missense probably benign 0.03
R4085:Sall3 UTSW 18 81,015,348 (GRCm39) missense probably damaging 0.99
R4764:Sall3 UTSW 18 81,017,691 (GRCm39) missense probably damaging 0.99
R4874:Sall3 UTSW 18 81,017,188 (GRCm39) missense probably benign 0.33
R4948:Sall3 UTSW 18 81,014,626 (GRCm39) missense probably benign 0.20
R5274:Sall3 UTSW 18 81,013,052 (GRCm39) missense probably benign 0.15
R5602:Sall3 UTSW 18 81,016,027 (GRCm39) missense probably benign
R6063:Sall3 UTSW 18 81,017,470 (GRCm39) missense possibly damaging 0.52
R6256:Sall3 UTSW 18 81,013,076 (GRCm39) missense possibly damaging 0.74
R6431:Sall3 UTSW 18 81,016,402 (GRCm39) missense possibly damaging 0.94
R6523:Sall3 UTSW 18 81,016,403 (GRCm39) missense possibly damaging 0.68
R6719:Sall3 UTSW 18 81,014,721 (GRCm39) missense probably damaging 0.99
R6861:Sall3 UTSW 18 81,017,590 (GRCm39) nonsense probably null
R7078:Sall3 UTSW 18 81,017,314 (GRCm39) missense probably damaging 0.97
R7107:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R7453:Sall3 UTSW 18 81,015,255 (GRCm39) missense probably benign 0.07
R7491:Sall3 UTSW 18 81,015,920 (GRCm39) missense probably benign 0.03
R7496:Sall3 UTSW 18 81,016,579 (GRCm39) missense probably benign 0.07
R7584:Sall3 UTSW 18 81,017,745 (GRCm39) missense probably benign 0.00
R7599:Sall3 UTSW 18 81,015,267 (GRCm39) missense possibly damaging 0.56
R7809:Sall3 UTSW 18 81,017,575 (GRCm39) missense probably benign 0.00
R8244:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8245:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8250:Sall3 UTSW 18 81,016,743 (GRCm39) missense probably benign 0.01
R8335:Sall3 UTSW 18 81,012,801 (GRCm39) missense probably benign 0.35
R8360:Sall3 UTSW 18 81,017,232 (GRCm39) missense probably benign 0.31
R8410:Sall3 UTSW 18 81,016,969 (GRCm39) missense probably benign 0.01
R8476:Sall3 UTSW 18 81,015,333 (GRCm39) nonsense probably null
R8712:Sall3 UTSW 18 81,017,236 (GRCm39) missense probably benign 0.03
R8726:Sall3 UTSW 18 81,029,708 (GRCm39) missense possibly damaging 0.89
R9192:Sall3 UTSW 18 81,017,124 (GRCm39) missense probably benign 0.05
R9653:Sall3 UTSW 18 81,016,228 (GRCm39) missense probably benign 0.03
R9701:Sall3 UTSW 18 81,017,443 (GRCm39) missense probably benign 0.07
Z1176:Sall3 UTSW 18 81,015,975 (GRCm39) missense probably benign 0.19
Z1177:Sall3 UTSW 18 81,017,491 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCAGCAATGCTAACCAG -3'
(R):5'- TCAGTACAGCTTCAGGGTCTGAC -3'

Sequencing Primer
(F):5'- TTGGGGAAGATGACACTGCTG -3'
(R):5'- TCAGGGTCTGACTCCCCATG -3'
Posted On 2019-05-15