Incidental Mutation 'R7109:Eif2ak4'
ID551378
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7109 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118405051 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 88 (P88S)
Ref Sequence ENSEMBL: ENSMUSP00000005233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]
Predicted Effect probably damaging
Transcript: ENSMUST00000005233
AA Change: P88S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: P88S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102527
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110872
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110874
AA Change: P10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: P10S

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110877
AA Change: P88S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: P88S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 2.6e-23 PFAM
Pfam:Pkinase_Tyr 327 535 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,473,753 K2Q probably damaging Het
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr1425 A G 19: 12,074,212 I140T probably benign Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pcnt T G 10: 76,369,904 E2538A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,236 W560R probably benign Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp51 A G 17: 21,463,569 R149G possibly damaging Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
Ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
R8004:Eif2ak4 UTSW 2 118417294 missense possibly damaging 0.64
R8063:Eif2ak4 UTSW 2 118410901 missense possibly damaging 0.94
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTCTGAGGTTAAAGAGATGC -3'
(R):5'- CAGGACAGGTTTATCACTCTAGC -3'

Sequencing Primer
(F):5'- AGATGCATGGCTGGTCAC -3'
(R):5'- CTTGGGAAACTCTTCAGAGAACCTG -3'
Posted On2019-05-15