Incidental Mutation 'R7109:4921509C19Rik'
ID551380
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene NameRIKEN cDNA 4921509C19 gene
SynonymsLOC381389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7109 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location151470542-151476153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 151473753 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 2 (K2Q)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
Predicted Effect probably damaging
Transcript: ENSMUST00000080132
AA Change: K2Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: K2Q

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Eif2ak4 C T 2: 118,405,051 P88S probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr1425 A G 19: 12,074,212 I140T probably benign Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pcnt T G 10: 76,369,904 E2538A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,236 W560R probably benign Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp51 A G 17: 21,463,569 R149G possibly damaging Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151473533 missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151473546 missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151472561 missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151473485 missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151472700 missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151472766 missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151472057 missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151472904 missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R4206:4921509C19Rik UTSW 2 151473515 missense probably benign 0.44
R4655:4921509C19Rik UTSW 2 151472858 missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151473470 missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151471871 missense unknown
R4702:4921509C19Rik UTSW 2 151472589 missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151472822 nonsense probably null
R4962:4921509C19Rik UTSW 2 151472808 missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151472540 missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151471931 missense probably benign
R5602:4921509C19Rik UTSW 2 151473539 missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151472880 missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151473307 missense probably damaging 1.00
R7079:4921509C19Rik UTSW 2 151473278 missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151473569 missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151472925 missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R7853:4921509C19Rik UTSW 2 151473680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATTTCGGGTTGGACAAGGG -3'
(R):5'- GGAGGCTATTCACACCTAAGAATTCC -3'

Sequencing Primer
(F):5'- GGACAAGGGAGTTTTTCCTGC -3'
(R):5'- ACTAAGACAGTTACTTTGGTCTTTG -3'
Posted On2019-05-15