Incidental Mutation 'R7109:Ppp1r3a'
ID 551386
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 045201-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7109 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14719235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 560 (W560R)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: W560R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: W560R

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,315,673 (GRCm39) K2Q probably damaging Het
Abtb2 T C 2: 103,545,860 (GRCm39) Y903H probably benign Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Alcam T A 16: 52,097,192 (GRCm39) T355S probably damaging Het
Anapc1 A G 2: 128,516,522 (GRCm39) V404A probably benign Het
Bst2 A G 8: 71,989,926 (GRCm39) F49S possibly damaging Het
C1qtnf9 G C 14: 61,017,019 (GRCm39) W183S probably benign Het
Camsap3 A G 8: 3,648,087 (GRCm39) I132V possibly damaging Het
Cchcr1 T A 17: 35,828,838 (GRCm39) probably null Het
Cenpk A G 13: 104,367,256 (GRCm39) K31E probably benign Het
Cfap221 T C 1: 119,853,301 (GRCm39) K798E possibly damaging Het
Copb2 T A 9: 98,463,333 (GRCm39) probably null Het
Dennd1a T A 2: 37,938,804 (GRCm39) Y102F probably damaging Het
Eif2ak4 C T 2: 118,235,532 (GRCm39) P88S probably damaging Het
Epha6 C A 16: 59,503,031 (GRCm39) V959F probably damaging Het
Fam193a C A 5: 34,623,165 (GRCm39) T1251K possibly damaging Het
Herc1 A T 9: 66,389,171 (GRCm39) Q3896L probably benign Het
Ikbip C A 10: 90,919,090 (GRCm39) D34E probably benign Het
Insr A G 8: 3,308,481 (GRCm39) V185A probably benign Het
Jakmip1 C T 5: 37,332,109 (GRCm39) Q930* probably null Het
Klc1 A G 12: 111,743,299 (GRCm39) I209V probably benign Het
Lrrk2 T A 15: 91,648,985 (GRCm39) L1660M probably damaging Het
Mbd3l1 G T 9: 18,396,210 (GRCm39) D112Y possibly damaging Het
Mrps2 T A 2: 28,358,258 (GRCm39) V16E probably benign Het
Ncoa1 G A 12: 4,372,978 (GRCm39) T141I possibly damaging Het
Ndst2 G T 14: 20,779,911 (GRCm39) R110S probably damaging Het
Nlrp2 A G 7: 5,331,616 (GRCm39) V260A probably damaging Het
Or4d10 A G 19: 12,051,576 (GRCm39) I140T probably benign Het
Or51a6 A T 7: 102,604,460 (GRCm39) V116E probably damaging Het
Or5p1 A G 7: 107,916,959 (GRCm39) N286S probably damaging Het
Or7g16 A T 9: 18,726,904 (GRCm39) S229T probably benign Het
Pah T C 10: 87,406,148 (GRCm39) V262A probably damaging Het
Pcnt T G 10: 76,205,738 (GRCm39) E2538A probably damaging Het
Pdxk T A 10: 78,282,810 (GRCm39) I162F probably damaging Het
Plod2 T C 9: 92,455,650 (GRCm39) F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 (GRCm39) L154Q probably damaging Het
Podxl2 C T 6: 88,820,566 (GRCm39) V445I possibly damaging Het
Rasal3 A G 17: 32,611,683 (GRCm39) S815P probably damaging Het
Rdm1 A G 11: 101,524,654 (GRCm39) K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn1a T C 2: 66,181,286 (GRCm39) D79G possibly damaging Het
Slc22a21 A G 11: 53,870,329 (GRCm39) Y119H possibly damaging Het
Stip1 C T 19: 6,999,178 (GRCm39) G467S possibly damaging Het
Synrg C A 11: 83,930,498 (GRCm39) A1280E possibly damaging Het
Szt2 A G 4: 118,232,676 (GRCm39) C2396R unknown Het
Trappc3 A G 4: 126,167,726 (GRCm39) N95S probably benign Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Ush2a T A 1: 188,113,681 (GRCm39) D633E probably benign Het
Wasl G A 6: 24,633,186 (GRCm39) P151S probably benign Het
Wwp2 A G 8: 108,209,988 (GRCm39) N122S probably benign Het
Zfp51 A G 17: 21,683,831 (GRCm39) R149G possibly damaging Het
Zfp764 A G 7: 127,003,887 (GRCm39) S415P possibly damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GATTGCTAGAGTCTGAGTTTTCCC -3'
(R):5'- GAAGAGTCAAATGCATCTTCCAGAG -3'

Sequencing Primer
(F):5'- CCCTGTCAGCTTGAAAAAGATG -3'
(R):5'- TCCAGAGATGATTATGCCAAAGTCG -3'
Posted On 2019-05-15