Mutagenetix > Incidental Mutation

Incidental Mutation 'R7109:Insr'

551395

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R7109 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3258481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 185 (V185A)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000091291
AA Change: V185A

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: V185A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	G	2: 151,473,753	K2Q	probably damaging	Het
Abtb2	T	C	2: 103,715,515	Y903H	probably benign	Het
Adamtsl3	C	T	7: 82,611,861	P29S		Het
Alcam	T	A	16: 52,276,829	T355S	probably damaging	Het
Anapc1	A	G	2: 128,674,602	V404A	probably benign	Het
Bst2	A	G	8: 71,537,282	F49S	possibly damaging	Het
C1qtnf9	G	C	14: 60,779,570	W183S	probably benign	Het
Camsap3	A	G	8: 3,598,087	I132V	possibly damaging	Het
Cchcr1	T	A	17: 35,517,941		probably null	Het
Cenpk	A	G	13: 104,230,748	K31E	probably benign	Het
Cfap221	T	C	1: 119,925,571	K798E	possibly damaging	Het
Copb2	T	A	9: 98,581,280		probably null	Het
Dennd1a	T	A	2: 38,048,792	Y102F	probably damaging	Het
Eif2ak4	C	T	2: 118,405,051	P88S	probably damaging	Het
Epha6	C	A	16: 59,682,668	V959F	probably damaging	Het
Fam193a	C	A	5: 34,465,821	T1251K	possibly damaging	Het
Herc1	A	T	9: 66,481,889	Q3896L	probably benign	Het
Ikbip	C	A	10: 91,083,228	D34E	probably benign	Het
Jakmip1	C	T	5: 37,174,765	Q930*	probably null	Het
Klc1	A	G	12: 111,776,865	I209V	probably benign	Het
Lrrk2	T	A	15: 91,764,782	L1660M	probably damaging	Het
Mbd3l1	G	T	9: 18,484,914	D112Y	possibly damaging	Het
Mrps2	T	A	2: 28,468,246	V16E	probably benign	Het
Ncoa1	G	A	12: 4,322,978	T141I	possibly damaging	Het
Ndst2	G	T	14: 20,729,843	R110S	probably damaging	Het
Nlrp2	A	G	7: 5,328,617	V260A	probably damaging	Het
Olfr1425	A	G	19: 12,074,212	I140T	probably benign	Het
Olfr491	A	G	7: 108,317,752	N286S	probably damaging	Het
Olfr575	A	T	7: 102,955,253	V116E	probably damaging	Het
Olfr828	A	T	9: 18,815,608	S229T	probably benign	Het
Pah	T	C	10: 87,570,286	V262A	probably damaging	Het
Pcnt	T	G	10: 76,369,904	E2538A	probably damaging	Het
Pdxk	T	A	10: 78,446,976	I162F	probably damaging	Het
Plod2	T	C	9: 92,573,597	F110L	probably damaging	Het
Pm20d2	A	T	4: 33,187,186	L154Q	probably damaging	Het
Podxl2	C	T	6: 88,843,584	V445I	possibly damaging	Het
Ppp1r3a	A	T	6: 14,719,236	W560R	probably benign	Het
Rasal3	A	G	17: 32,392,709	S815P	probably damaging	Het
Rdm1	A	G	11: 101,633,828	K196E	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Scn1a	T	C	2: 66,350,942	D79G	possibly damaging	Het
Slc22a21	A	G	11: 53,979,503	Y119H	possibly damaging	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Synrg	C	A	11: 84,039,672	A1280E	possibly damaging	Het
Szt2	A	G	4: 118,375,479	C2396R	unknown	Het
Trappc3	A	G	4: 126,273,933	N95S	probably benign	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Ush2a	T	A	1: 188,381,484	D633E	probably benign	Het
Wasl	G	A	6: 24,633,187	P151S	probably benign	Het
Wwp2	A	G	8: 107,483,356	N122S	probably benign	Het
Zfp51	A	G	17: 21,463,569	R149G	possibly damaging	Het
Zfp764	A	G	7: 127,404,715	S415P	possibly damaging	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1568:Insr	UTSW	8	3165576	missense	probably benign
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4081:Insr	UTSW	8	3211391	missense	probably benign	0.00
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4687:Insr	UTSW	8	3161709	missense	probably benign	0.42
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5176:Insr	UTSW	8	3158742	missense	probably benign	0.03
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TATGCCTCGCAGATAAGGGGAC -3'
(R):5'- TTCGAGATGGTCCACCTGAAG -3'

Sequencing Primer
(F):5'- TCCATCACCTAAACTTTTACAGGAG -3'
(R):5'- TCCACCTGAAGGAGCTGG -3'

Posted On

2019-05-15