Incidental Mutation 'R7109:Insr'
ID 551395
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Name insulin receptor
Synonyms 4932439J01Rik, D630014A15Rik, IR, IR-B, IR-A, CD220
MMRRC Submission 045201-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.880) question?
Stock # R7109 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 3200922-3329649 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3308481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
AlphaFold P15208
PDB Structure 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000091291
AA Change: V185A

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: V185A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,315,673 (GRCm39) K2Q probably damaging Het
Abtb2 T C 2: 103,545,860 (GRCm39) Y903H probably benign Het
Adamtsl3 C T 7: 82,261,069 (GRCm39) P29S Het
Alcam T A 16: 52,097,192 (GRCm39) T355S probably damaging Het
Anapc1 A G 2: 128,516,522 (GRCm39) V404A probably benign Het
Bst2 A G 8: 71,989,926 (GRCm39) F49S possibly damaging Het
C1qtnf9 G C 14: 61,017,019 (GRCm39) W183S probably benign Het
Camsap3 A G 8: 3,648,087 (GRCm39) I132V possibly damaging Het
Cchcr1 T A 17: 35,828,838 (GRCm39) probably null Het
Cenpk A G 13: 104,367,256 (GRCm39) K31E probably benign Het
Cfap221 T C 1: 119,853,301 (GRCm39) K798E possibly damaging Het
Copb2 T A 9: 98,463,333 (GRCm39) probably null Het
Dennd1a T A 2: 37,938,804 (GRCm39) Y102F probably damaging Het
Eif2ak4 C T 2: 118,235,532 (GRCm39) P88S probably damaging Het
Epha6 C A 16: 59,503,031 (GRCm39) V959F probably damaging Het
Fam193a C A 5: 34,623,165 (GRCm39) T1251K possibly damaging Het
Herc1 A T 9: 66,389,171 (GRCm39) Q3896L probably benign Het
Ikbip C A 10: 90,919,090 (GRCm39) D34E probably benign Het
Jakmip1 C T 5: 37,332,109 (GRCm39) Q930* probably null Het
Klc1 A G 12: 111,743,299 (GRCm39) I209V probably benign Het
Lrrk2 T A 15: 91,648,985 (GRCm39) L1660M probably damaging Het
Mbd3l1 G T 9: 18,396,210 (GRCm39) D112Y possibly damaging Het
Mrps2 T A 2: 28,358,258 (GRCm39) V16E probably benign Het
Ncoa1 G A 12: 4,372,978 (GRCm39) T141I possibly damaging Het
Ndst2 G T 14: 20,779,911 (GRCm39) R110S probably damaging Het
Nlrp2 A G 7: 5,331,616 (GRCm39) V260A probably damaging Het
Or4d10 A G 19: 12,051,576 (GRCm39) I140T probably benign Het
Or51a6 A T 7: 102,604,460 (GRCm39) V116E probably damaging Het
Or5p1 A G 7: 107,916,959 (GRCm39) N286S probably damaging Het
Or7g16 A T 9: 18,726,904 (GRCm39) S229T probably benign Het
Pah T C 10: 87,406,148 (GRCm39) V262A probably damaging Het
Pcnt T G 10: 76,205,738 (GRCm39) E2538A probably damaging Het
Pdxk T A 10: 78,282,810 (GRCm39) I162F probably damaging Het
Plod2 T C 9: 92,455,650 (GRCm39) F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 (GRCm39) L154Q probably damaging Het
Podxl2 C T 6: 88,820,566 (GRCm39) V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,235 (GRCm39) W560R probably benign Het
Rasal3 A G 17: 32,611,683 (GRCm39) S815P probably damaging Het
Rdm1 A G 11: 101,524,654 (GRCm39) K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Scn1a T C 2: 66,181,286 (GRCm39) D79G possibly damaging Het
Slc22a21 A G 11: 53,870,329 (GRCm39) Y119H possibly damaging Het
Stip1 C T 19: 6,999,178 (GRCm39) G467S possibly damaging Het
Synrg C A 11: 83,930,498 (GRCm39) A1280E possibly damaging Het
Szt2 A G 4: 118,232,676 (GRCm39) C2396R unknown Het
Trappc3 A G 4: 126,167,726 (GRCm39) N95S probably benign Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Ush2a T A 1: 188,113,681 (GRCm39) D633E probably benign Het
Wasl G A 6: 24,633,186 (GRCm39) P151S probably benign Het
Wwp2 A G 8: 108,209,988 (GRCm39) N122S probably benign Het
Zfp51 A G 17: 21,683,831 (GRCm39) R149G possibly damaging Het
Zfp764 A G 7: 127,003,887 (GRCm39) S415P possibly damaging Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3,308,682 (GRCm39) missense probably damaging 1.00
IGL01986:Insr APN 8 3,208,817 (GRCm39) missense probably damaging 1.00
IGL02135:Insr APN 8 3,308,741 (GRCm39) missense probably damaging 1.00
IGL02203:Insr APN 8 3,205,817 (GRCm39) missense probably benign 0.18
IGL02220:Insr APN 8 3,209,578 (GRCm39) missense probably damaging 1.00
IGL02678:Insr APN 8 3,223,570 (GRCm39) missense probably benign 0.00
IGL02961:Insr APN 8 3,308,785 (GRCm39) missense probably benign 0.08
IGL03099:Insr APN 8 3,308,715 (GRCm39) missense probably damaging 1.00
IGL03125:Insr APN 8 3,234,972 (GRCm39) missense possibly damaging 0.87
IGL03290:Insr APN 8 3,308,574 (GRCm39) missense probably damaging 1.00
gummi_bear UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
jellybelly UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
Patently UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
trolli UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R0047:Insr UTSW 8 3,252,947 (GRCm39) missense probably damaging 0.97
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0480:Insr UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
R0748:Insr UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
R0919:Insr UTSW 8 3,208,769 (GRCm39) missense probably damaging 1.00
R1348:Insr UTSW 8 3,242,635 (GRCm39) missense probably damaging 1.00
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1568:Insr UTSW 8 3,215,576 (GRCm39) missense probably benign
R1768:Insr UTSW 8 3,209,561 (GRCm39) missense probably damaging 1.00
R2093:Insr UTSW 8 3,254,762 (GRCm39) missense probably damaging 1.00
R2111:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2112:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2352:Insr UTSW 8 3,242,593 (GRCm39) missense probably damaging 1.00
R2364:Insr UTSW 8 3,224,820 (GRCm39) missense probably benign
R2842:Insr UTSW 8 3,252,986 (GRCm39) missense probably damaging 1.00
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R4081:Insr UTSW 8 3,261,391 (GRCm39) missense probably benign 0.00
R4441:Insr UTSW 8 3,244,902 (GRCm39) missense probably benign 0.00
R4672:Insr UTSW 8 3,217,501 (GRCm39) critical splice donor site probably null
R4687:Insr UTSW 8 3,211,709 (GRCm39) missense probably benign 0.42
R4708:Insr UTSW 8 3,261,346 (GRCm39) intron probably benign
R4890:Insr UTSW 8 3,248,234 (GRCm39) missense probably benign 0.16
R4949:Insr UTSW 8 3,235,059 (GRCm39) missense probably benign 0.04
R4996:Insr UTSW 8 3,242,665 (GRCm39) missense probably null 0.98
R5073:Insr UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
R5176:Insr UTSW 8 3,208,742 (GRCm39) missense probably benign 0.03
R5200:Insr UTSW 8 3,248,059 (GRCm39) critical splice donor site probably null
R5323:Insr UTSW 8 3,252,902 (GRCm39) missense probably benign 0.02
R5453:Insr UTSW 8 3,205,694 (GRCm39) missense probably benign 0.06
R5516:Insr UTSW 8 3,205,764 (GRCm39) nonsense probably null
R5704:Insr UTSW 8 3,235,122 (GRCm39) missense possibly damaging 0.52
R5820:Insr UTSW 8 3,205,976 (GRCm39) missense probably damaging 1.00
R5879:Insr UTSW 8 3,248,173 (GRCm39) nonsense probably null
R5894:Insr UTSW 8 3,224,869 (GRCm39) missense possibly damaging 0.88
R5937:Insr UTSW 8 3,224,808 (GRCm39) missense probably benign
R5966:Insr UTSW 8 3,308,697 (GRCm39) missense probably benign 0.04
R6134:Insr UTSW 8 3,242,572 (GRCm39) missense probably damaging 1.00
R6352:Insr UTSW 8 3,223,479 (GRCm39) critical splice donor site probably null
R6423:Insr UTSW 8 3,223,566 (GRCm39) missense probably benign
R6687:Insr UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R6985:Insr UTSW 8 3,211,372 (GRCm39) missense possibly damaging 0.87
R6993:Insr UTSW 8 3,308,752 (GRCm39) missense probably damaging 1.00
R7041:Insr UTSW 8 3,308,418 (GRCm39) missense probably benign
R7216:Insr UTSW 8 3,253,034 (GRCm39) missense possibly damaging 0.53
R7287:Insr UTSW 8 3,219,717 (GRCm39) missense probably benign 0.00
R7378:Insr UTSW 8 3,248,231 (GRCm39) missense probably damaging 1.00
R7525:Insr UTSW 8 3,242,642 (GRCm39) missense probably damaging 1.00
R7572:Insr UTSW 8 3,223,602 (GRCm39) missense probably benign 0.11
R7636:Insr UTSW 8 3,308,709 (GRCm39) missense probably damaging 1.00
R7684:Insr UTSW 8 3,219,753 (GRCm39) missense possibly damaging 0.85
R7840:Insr UTSW 8 3,308,415 (GRCm39) missense probably benign 0.04
R8075:Insr UTSW 8 3,205,862 (GRCm39) missense probably benign 0.17
R8161:Insr UTSW 8 3,308,660 (GRCm39) missense probably damaging 1.00
R8220:Insr UTSW 8 3,208,702 (GRCm39) missense probably benign 0.01
R8434:Insr UTSW 8 3,215,514 (GRCm39) splice site probably benign
R8810:Insr UTSW 8 3,219,714 (GRCm39) missense probably benign
R8865:Insr UTSW 8 3,211,358 (GRCm39) missense probably damaging 1.00
R8884:Insr UTSW 8 3,205,679 (GRCm39) missense probably benign
R9134:Insr UTSW 8 3,308,413 (GRCm39) missense probably damaging 1.00
R9359:Insr UTSW 8 3,208,717 (GRCm39) missense probably damaging 1.00
R9407:Insr UTSW 8 3,235,106 (GRCm39) missense probably benign
R9647:Insr UTSW 8 3,205,874 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TATGCCTCGCAGATAAGGGGAC -3'
(R):5'- TTCGAGATGGTCCACCTGAAG -3'

Sequencing Primer
(F):5'- TCCATCACCTAAACTTTTACAGGAG -3'
(R):5'- TCCACCTGAAGGAGCTGG -3'
Posted On 2019-05-15