Incidental Mutation 'R7109:Pcnt'
ID 551404
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Name pericentrin (kendrin)
Synonyms m239Asp, m275Asp, Pcnt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7109 (G1)
Quality Score 135.008
Status Not validated
Chromosome 10
Chromosomal Location 76351263-76442786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 76369904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 2538 (E2538A)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000001179
AA Change: E2556A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: E2556A

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000217838
AA Change: E2538A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219243
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,473,753 K2Q probably damaging Het
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Eif2ak4 C T 2: 118,405,051 P88S probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr1425 A G 19: 12,074,212 I140T probably benign Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,236 W560R probably benign Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp51 A G 17: 21,463,569 R149G possibly damaging Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 splice site probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense probably benign
R7575:Pcnt UTSW 10 76389252 missense probably benign 0.32
R7662:Pcnt UTSW 10 76387522 missense probably benign 0.27
R7685:Pcnt UTSW 10 76422808 missense probably benign 0.14
R7764:Pcnt UTSW 10 76354248 missense probably benign 0.33
R7802:Pcnt UTSW 10 76375303 splice site probably null
R8432:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8439:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8493:Pcnt UTSW 10 76403623 critical splice donor site probably null
R8530:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8535:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8830:Pcnt UTSW 10 76382174 missense probably benign 0.03
R8878:Pcnt UTSW 10 76408841 missense probably damaging 1.00
R8911:Pcnt UTSW 10 76387525 missense probably damaging 0.98
R8988:Pcnt UTSW 10 76409573 nonsense probably null
R9084:Pcnt UTSW 10 76399992 missense probably benign 0.09
R9169:Pcnt UTSW 10 76385738 missense possibly damaging 0.95
R9372:Pcnt UTSW 10 76423126 missense probably damaging 1.00
R9411:Pcnt UTSW 10 76423062 missense probably damaging 0.96
R9448:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R9459:Pcnt UTSW 10 76392738 missense probably damaging 1.00
Z1176:Pcnt UTSW 10 76382157 nonsense probably null
Z1177:Pcnt UTSW 10 76399968 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTTAAATCAAAGGTGTCCG -3'
(R):5'- GTTGGAGATACAGCGTCAGC -3'

Sequencing Primer
(F):5'- GCCAAATCGACCTTGTTGG -3'
(R):5'- CGTCAGCGTGATGAGCATAAGATC -3'
Posted On 2019-05-15