Incidental Mutation 'R7109:Zfp51'
ID551420
Institutional Source Beutler Lab
Gene Symbol Zfp51
Ensembl Gene ENSMUSG00000023892
Gene Namezinc finger protein 51
SynonymsZfp-51, zfec12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7109 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21450374-21465587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21463569 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 149 (R149G)
Ref Sequence ENSEMBL: ENSMUSP00000045684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039577
AA Change: R149G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045684
Gene: ENSMUSG00000023892
AA Change: R149G

DomainStartEndE-ValueType
KRAB 43 103 1.71e-22 SMART
ZnF_C2H2 214 236 2.36e-2 SMART
ZnF_C2H2 242 264 8.94e-3 SMART
ZnF_C2H2 270 292 7.9e-4 SMART
ZnF_C2H2 298 320 3.44e-4 SMART
ZnF_C2H2 326 348 7.15e-2 SMART
ZnF_C2H2 354 376 4.54e-4 SMART
ZnF_C2H2 382 404 3.44e-4 SMART
ZnF_C2H2 410 432 9.88e-5 SMART
ZnF_C2H2 438 460 3.16e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
ZnF_C2H2 494 517 2.57e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 1.4e-4 SMART
ZnF_C2H2 579 601 4.17e-3 SMART
ZnF_C2H2 607 629 2.79e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 9.08e-4 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
ZnF_C2H2 719 741 1.36e-2 SMART
ZnF_C2H2 747 769 6.82e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,473,753 K2Q probably damaging Het
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Eif2ak4 C T 2: 118,405,051 P88S probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr1425 A G 19: 12,074,212 I140T probably benign Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pcnt T G 10: 76,369,904 E2538A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Ppp1r3a A T 6: 14,719,236 W560R probably benign Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in Zfp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp51 APN 17 21463452 missense probably benign 0.11
IGL00971:Zfp51 APN 17 21463582 missense probably benign 0.03
IGL02002:Zfp51 APN 17 21463959 missense probably damaging 0.98
IGL02268:Zfp51 APN 17 21463419 nonsense probably null
IGL03249:Zfp51 APN 17 21463439 missense probably damaging 1.00
R1569:Zfp51 UTSW 17 21456380 missense probably benign 0.01
R1853:Zfp51 UTSW 17 21464323 missense probably damaging 1.00
R1989:Zfp51 UTSW 17 21456320 missense possibly damaging 0.90
R2285:Zfp51 UTSW 17 21463875 missense probably damaging 1.00
R2407:Zfp51 UTSW 17 21463831 missense probably damaging 0.98
R2890:Zfp51 UTSW 17 21463856 missense probably damaging 1.00
R3918:Zfp51 UTSW 17 21463440 missense probably benign
R4529:Zfp51 UTSW 17 21464736 missense probably damaging 1.00
R4587:Zfp51 UTSW 17 21464916 nonsense probably null
R4866:Zfp51 UTSW 17 21461750 missense possibly damaging 0.61
R4872:Zfp51 UTSW 17 21464671 missense probably benign 0.26
R4961:Zfp51 UTSW 17 21456353 missense probably benign 0.01
R5392:Zfp51 UTSW 17 21465322 missense possibly damaging 0.60
R5611:Zfp51 UTSW 17 21464092 missense probably damaging 1.00
R7129:Zfp51 UTSW 17 21461709 missense probably damaging 1.00
R7269:Zfp51 UTSW 17 21463698 missense probably benign 0.09
R7303:Zfp51 UTSW 17 21463796 missense probably benign 0.24
R7514:Zfp51 UTSW 17 21463500 missense probably benign 0.37
R7665:Zfp51 UTSW 17 21463581 missense probably benign 0.00
R8073:Zfp51 UTSW 17 21464032 missense probably damaging 1.00
R8177:Zfp51 UTSW 17 21463867 missense probably benign 0.05
X0062:Zfp51 UTSW 17 21464995 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGACTTAAGCGAGAACATAGGG -3'
(R):5'- GGTTGCATGAGACTGTATGCA -3'

Sequencing Primer
(F):5'- CTGCATATGTGATACAGTCCATCAAC -3'
(R):5'- CTGTATGCAGAGCTGAAATAGTC -3'
Posted On2019-05-15