Incidental Mutation 'R7110:Ccdc73'
ID 551430
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 045202-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7110 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104716669-104830082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104803569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 236 (M236V)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect probably benign
Transcript: ENSMUST00000111114
AA Change: M236V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: M236V

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
AA Change: M236V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106
AA Change: M236V

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,316,571 (GRCm39) T184A possibly damaging Het
Abca4 T A 3: 121,926,292 (GRCm39) Y1243N probably damaging Het
Adamts7 A G 9: 90,076,017 (GRCm39) T1250A possibly damaging Het
Adgrg3 T C 8: 95,761,591 (GRCm39) V118A possibly damaging Het
Agrn A G 4: 156,263,332 (GRCm39) V364A possibly damaging Het
Cacna2d1 C A 5: 16,562,782 (GRCm39) L853I probably damaging Het
Ccdc25 A G 14: 66,094,165 (GRCm39) K124R probably benign Het
Cdh1 G A 8: 107,395,176 (GRCm39) D862N possibly damaging Het
Cdh5 A G 8: 104,867,400 (GRCm39) D559G probably damaging Het
Celsr2 C A 3: 108,305,181 (GRCm39) G2133C probably damaging Het
Chd5 A G 4: 152,469,896 (GRCm39) N1823S probably damaging Het
Cog7 T C 7: 121,534,999 (GRCm39) N562S probably damaging Het
Dcaf6 A T 1: 165,179,537 (GRCm39) S534R probably benign Het
Donson G A 16: 91,479,009 (GRCm39) R436* probably null Het
Fam53c T A 18: 34,895,523 (GRCm39) probably null Het
Foxi3 A G 6: 70,937,730 (GRCm39) T321A probably benign Het
Frmd4b A T 6: 97,273,192 (GRCm39) Y733* probably null Het
Fscn2 A T 11: 120,257,580 (GRCm39) T314S probably benign Het
Gfral A G 9: 76,072,112 (GRCm39) I386T possibly damaging Het
Gm21698 T C 5: 26,190,175 (GRCm39) E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gprin1 T C 13: 54,887,056 (GRCm39) D406G probably benign Het
Habp2 A T 19: 56,299,596 (GRCm39) R128* probably null Het
Hoxc10 A T 15: 102,879,356 (GRCm39) Y292F probably damaging Het
Hydin A T 8: 111,081,583 (GRCm39) probably null Het
Igkv12-89 T C 6: 68,812,115 (GRCm39) D18G probably damaging Het
Jhy T C 9: 40,828,556 (GRCm39) N450S probably damaging Het
Klhl18 T A 9: 110,279,833 (GRCm39) Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lsmem1 A T 12: 40,235,272 (GRCm39) probably null Het
Ly75 A G 2: 60,206,528 (GRCm39) I47T probably benign Het
Med12l C A 3: 59,169,645 (GRCm39) T1603K possibly damaging Het
Mgat5 A G 1: 127,310,716 (GRCm39) D210G possibly damaging Het
Mgmt G T 7: 136,687,715 (GRCm39) G55W probably damaging Het
Mrpl57 G A 14: 58,063,754 (GRCm39) probably benign Het
Mtg1 G A 7: 139,726,779 (GRCm39) R209Q probably benign Het
Muc21 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,933,510 (GRCm39) probably benign Het
Muc5ac T G 7: 141,353,559 (GRCm39) C826W possibly damaging Het
Myot A G 18: 44,474,453 (GRCm39) D146G probably damaging Het
Nlrp4f T A 13: 65,347,160 (GRCm39) I11F probably damaging Het
Nsun5 T A 5: 135,400,104 (GRCm39) Y76N probably damaging Het
Or7a42 A T 10: 78,791,284 (GRCm39) M82L possibly damaging Het
Pcdhb3 A G 18: 37,435,975 (GRCm39) N647S possibly damaging Het
Pdgfra T A 5: 75,349,895 (GRCm39) Y926* probably null Het
Pdzd2 A T 15: 12,368,099 (GRCm39) L2630H probably damaging Het
Phox2b G A 5: 67,253,505 (GRCm39) S297L unknown Het
Polr3e T A 7: 120,539,510 (GRCm39) probably null Het
Ppp4r2 T A 6: 100,842,823 (GRCm39) V238E probably damaging Het
Proc A T 18: 32,266,441 (GRCm39) F129I probably benign Het
Sgca T A 11: 94,854,227 (GRCm39) probably null Het
Slc7a10 A G 7: 34,899,009 (GRCm39) H360R probably benign Het
Slurp2 G A 15: 74,614,964 (GRCm39) T59I probably benign Het
Son A G 16: 91,453,406 (GRCm39) T718A probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spink7 T C 18: 62,727,338 (GRCm39) N62S probably damaging Het
Stxbp3 C A 3: 108,723,649 (GRCm39) R195S probably damaging Het
Sulf1 G A 1: 12,908,825 (GRCm39) V613M probably damaging Het
Tbc1d9b A T 11: 50,054,657 (GRCm39) I934F probably benign Het
Tecpr2 T G 12: 110,885,406 (GRCm39) L195R probably damaging Het
Tns2 G C 15: 102,013,801 (GRCm39) C71S probably damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp40 G T 1: 87,913,884 (GRCm39) T403K probably benign Het
Vat1 G T 11: 101,356,539 (GRCm39) R141S possibly damaging Het
Vmn2r28 T G 7: 5,493,733 (GRCm39) N71T probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104,824,936 (GRCm39) missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104,737,972 (GRCm39) missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104,805,961 (GRCm39) missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104,737,913 (GRCm39) missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
FR4737:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104,782,281 (GRCm39) missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104,811,332 (GRCm39) splice site probably benign
R0040:Ccdc73 UTSW 2 104,822,429 (GRCm39) missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104,759,915 (GRCm39) splice site probably benign
R0360:Ccdc73 UTSW 2 104,811,352 (GRCm39) missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104,821,634 (GRCm39) missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104,803,499 (GRCm39) splice site probably benign
R0839:Ccdc73 UTSW 2 104,821,442 (GRCm39) missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104,822,535 (GRCm39) missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104,821,906 (GRCm39) missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104,745,012 (GRCm39) missense possibly damaging 0.93
R1478:Ccdc73 UTSW 2 104,737,955 (GRCm39) missense possibly damaging 0.72
R1695:Ccdc73 UTSW 2 104,822,450 (GRCm39) missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104,822,637 (GRCm39) missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104,757,280 (GRCm39) missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104,829,504 (GRCm39) missense probably damaging 1.00
R1987:Ccdc73 UTSW 2 104,761,390 (GRCm39) nonsense probably null
R2938:Ccdc73 UTSW 2 104,805,980 (GRCm39) nonsense probably null
R3420:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3420:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3422:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3422:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3522:Ccdc73 UTSW 2 104,821,830 (GRCm39) missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104,821,688 (GRCm39) missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104,815,355 (GRCm39) missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104,811,450 (GRCm39) splice site probably null
R4793:Ccdc73 UTSW 2 104,848,127 (GRCm39) splice site probably null
R4939:Ccdc73 UTSW 2 104,822,502 (GRCm39) splice site probably null
R4950:Ccdc73 UTSW 2 104,822,711 (GRCm39) missense probably benign
R5093:Ccdc73 UTSW 2 104,848,111 (GRCm39) utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104,822,384 (GRCm39) missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104,820,270 (GRCm39) missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104,761,331 (GRCm39) missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104,822,482 (GRCm39) missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104,737,978 (GRCm39) missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104,822,433 (GRCm39) missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104,821,869 (GRCm39) nonsense probably null
R7062:Ccdc73 UTSW 2 104,782,223 (GRCm39) missense probably damaging 1.00
R7320:Ccdc73 UTSW 2 104,829,521 (GRCm39) missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104,782,214 (GRCm39) missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104,824,915 (GRCm39) missense
R7747:Ccdc73 UTSW 2 104,759,901 (GRCm39) missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104,775,801 (GRCm39) critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104,821,557 (GRCm39) missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104,822,222 (GRCm39) missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8928:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8945:Ccdc73 UTSW 2 104,821,712 (GRCm39) missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104,738,011 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104,822,584 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACAGTTGTGAGAGGGGCC -3'
(R):5'- CCTGAAGCTACATTTGAATGGG -3'

Sequencing Primer
(F):5'- GTTCCAAATAAAAGTATGGGATCTGC -3'
(R):5'- GTGCAACAATCCTGAAGTTC -3'
Posted On 2019-05-15