Mutagenetix > Incidental Mutation

Incidental Mutation 'R7110:Agrn'

551436

Institutional Source

Beutler Lab

Gene Symbol

Agrn

Ensembl Gene

ENSMUSG00000041936

Gene Name

agrin

Synonyms

NMF380, Agrin, nmf380

MMRRC Submission

Accession Numbers

Genbank: NM_021604; MGI: 87961

Essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R7110 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

156165290-156197488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 156178875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 364 (V364A)

Ref Sequence

ENSEMBL: ENSMUSP00000137931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]

AlphaFold

A2ASQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000071248
AA Change: V257A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936
AA Change: V257A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1139	5.57e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105574
AA Change: V257A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: V257A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1678	6.51e-36	SMART
EGF	1699	1735	4.35e-6	SMART
LamG	1771	1907	5.01e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105575
AA Change: V257A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: V257A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1682	9.2e-36	SMART
EGF	1703	1739	4.35e-6	SMART
LamG	1794	1930	5.01e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180572
AA Change: V364A

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: V364A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:NtA	32	159	5.1e-91	PFAM
FOLN	173	198	8.25e-6	SMART
KAZAL	198	244	1.22e-17	SMART
FOLN	249	273	7.58e-5	SMART
EGF_like	249	288	7.38e1	SMART
KAZAL	273	319	1.51e-13	SMART
KAZAL	348	391	1.8e-6	SMART
KAZAL	417	463	1.55e-10	SMART
FOLN	469	491	8.25e-6	SMART
KAZAL	491	536	1.14e-17	SMART
KAZAL	556	601	6.43e-17	SMART
FOLN	603	626	2.94e-2	SMART
KAZAL	614	666	8.96e-16	SMART
low complexity region	672	679	N/A	INTRINSIC
KAZAL	706	752	1.12e-16	SMART
EGF_Lam	795	846	3.29e-15	SMART
EGF_Lam	849	893	6.7e-7	SMART
FOLN	902	924	1.94e-2	SMART
KAZAL	924	971	3.9e-16	SMART
low complexity region	996	1013	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
SEA	1121	1243	2.26e-35	SMART
low complexity region	1249	1276	N/A	INTRINSIC
low complexity region	1290	1305	N/A	INTRINSIC
EGF	1321	1356	1.49e-4	SMART
LamG	1381	1517	4e-45	SMART
EGF	1541	1575	2.23e-3	SMART
EGF	1580	1614	7.13e-2	SMART
LamG	1649	1785	6.51e-36	SMART
EGF	1806	1842	4.35e-6	SMART
LamG	1878	2014	5.01e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	A	G	11: 58,425,745	T184A	possibly damaging	Het
Abca4	T	A	3: 122,132,643	Y1243N	probably damaging	Het
Adamts7	A	G	9: 90,193,964	T1250A	possibly damaging	Het
Adgrg3	T	C	8: 95,034,963	V118A	possibly damaging	Het
Cacna2d1	C	A	5: 16,357,784	L853I	probably damaging	Het
Ccdc25	A	G	14: 65,856,716	K124R	probably benign	Het
Ccdc73	A	G	2: 104,973,224	M236V	probably benign	Het
Cdh1	G	A	8: 106,668,544	D862N	possibly damaging	Het
Cdh5	A	G	8: 104,140,768	D559G	probably damaging	Het
Celsr2	C	A	3: 108,397,865	G2133C	probably damaging	Het
Chd5	A	G	4: 152,385,439	N1823S	probably damaging	Het
Cog7	T	C	7: 121,935,776	N562S	probably damaging	Het
Dcaf6	A	T	1: 165,351,968	S534R	probably benign	Het
Donson	G	A	16: 91,682,121	R436*	probably null	Het
Fam53c	T	A	18: 34,762,470		probably null	Het
Foxi3	A	G	6: 70,960,746	T321A	probably benign	Het
Frmd4b	A	T	6: 97,296,231	Y733*	probably null	Het
Fscn2	A	T	11: 120,366,754	T314S	probably benign	Het
Gfral	A	G	9: 76,164,830	I386T	possibly damaging	Het
Gm21698	T	C	5: 25,985,177	E174G	probably damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gm9573	CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT	CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT	17: 35,622,618		probably benign	Het
Gprin1	T	C	13: 54,739,243	D406G	probably benign	Het
Habp2	A	T	19: 56,311,164	R128*	probably null	Het
Hoxc10	A	T	15: 102,970,921	Y292F	probably damaging	Het
Hydin	A	T	8: 110,354,951		probably null	Het
Igkv12-89	T	C	6: 68,835,131	D18G	probably damaging	Het
Jhy	T	C	9: 40,917,260	N450S	probably damaging	Het
Klhl18	T	A	9: 110,450,765	Q119L	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lsmem1	A	T	12: 40,185,273		probably null	Het
Ly75	A	G	2: 60,376,184	I47T	probably benign	Het
Med12l	C	A	3: 59,262,224	T1603K	possibly damaging	Het
Mgat5	A	G	1: 127,382,979	D210G	possibly damaging	Het
Mgmt	G	T	7: 137,085,986	G55W	probably damaging	Het
Mrpl57	G	A	14: 57,826,297		probably benign	Het
Mtg1	G	A	7: 140,146,866	R209Q	probably benign	Het
Muc5ac	T	G	7: 141,799,822	C826W	possibly damaging	Het
Myot	A	G	18: 44,341,386	D146G	probably damaging	Het
Nlrp4f	T	A	13: 65,199,346	I11F	probably damaging	Het
Nsun5	T	A	5: 135,371,250	Y76N	probably damaging	Het
Olfr8	A	T	10: 78,955,450	M82L	possibly damaging	Het
Pcdhb3	A	G	18: 37,302,922	N647S	possibly damaging	Het
Pdgfra	T	A	5: 75,189,234	Y926*	probably null	Het
Pdzd2	A	T	15: 12,368,013	L2630H	probably damaging	Het
Phox2b	G	A	5: 67,096,162	S297L	unknown	Het
Polr3e	T	A	7: 120,940,287		probably null	Het
Ppp4r2	T	A	6: 100,865,862	V238E	probably damaging	Het
Proc	A	T	18: 32,133,388	F129I	probably benign	Het
Sgca	T	A	11: 94,963,401		probably null	Het
Slc7a10	A	G	7: 35,199,584	H360R	probably benign	Het
Slurp2	G	A	15: 74,743,115	T59I	probably benign	Het
Son	A	G	16: 91,656,518	T718A	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spink7	T	C	18: 62,594,267	N62S	probably damaging	Het
Stxbp3	C	A	3: 108,816,333	R195S	probably damaging	Het
Sulf1	G	A	1: 12,838,601	V613M	probably damaging	Het
Tbc1d9b	A	T	11: 50,163,830	I934F	probably benign	Het
Tecpr2	T	G	12: 110,918,972	L195R	probably damaging	Het
Tns2	G	C	15: 102,105,366	C71S	probably damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp40	G	T	1: 87,986,162	T403K	probably benign	Het
Vat1	G	T	11: 101,465,713	R141S	possibly damaging	Het
Vmn2r28	T	G	7: 5,490,734	N71T	probably benign	Het

Other mutations in Agrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Agrn	APN	4	156170572	splice site	probably benign
IGL00811:Agrn	APN	4	156168774	missense	possibly damaging	0.70
IGL01066:Agrn	APN	4	156177343	missense	probably benign	0.00
IGL01412:Agrn	APN	4	156171034	splice site	probably benign
IGL01414:Agrn	APN	4	156195239	splice site	probably null
IGL02075:Agrn	APN	4	156170210	missense	probably benign	0.40
IGL02609:Agrn	APN	4	156175223	splice site	probably benign
IGL02669:Agrn	APN	4	156174561	splice site	probably benign
IGL02671:Agrn	APN	4	156174561	splice site	probably benign
IGL02672:Agrn	APN	4	156174561	splice site	probably benign
IGL02674:Agrn	APN	4	156174561	splice site	probably benign
IGL02724:Agrn	APN	4	156172807	nonsense	probably null
IGL02804:Agrn	APN	4	156174055	missense	probably benign	0.00
IGL02986:Agrn	APN	4	156178854	missense	possibly damaging	0.84
IGL03160:Agrn	APN	4	156170363	missense	probably damaging	0.98
BB004:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
BB014:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
F6893:Agrn	UTSW	4	156174179	missense	probably benign
R0092:Agrn	UTSW	4	156178953	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0482:Agrn	UTSW	4	156173555	missense	probably damaging	0.98
R0531:Agrn	UTSW	4	156179434	missense	probably benign	0.38
R0536:Agrn	UTSW	4	156179553	missense	probably benign	0.01
R0690:Agrn	UTSW	4	156174453	missense	probably damaging	1.00
R0750:Agrn	UTSW	4	156166937	nonsense	probably null
R1079:Agrn	UTSW	4	156177225	missense	probably damaging	1.00
R1199:Agrn	UTSW	4	156172299	missense	probably benign	0.00
R1222:Agrn	UTSW	4	156177385	missense	probably damaging	0.99
R1534:Agrn	UTSW	4	156176684	missense	probably damaging	1.00
R1587:Agrn	UTSW	4	156179440	missense	probably damaging	0.99
R1625:Agrn	UTSW	4	156172860	missense	probably damaging	1.00
R1698:Agrn	UTSW	4	156166558	missense	probably benign	0.03
R1717:Agrn	UTSW	4	156166519	frame shift	probably null
R1718:Agrn	UTSW	4	156166519	frame shift	probably null
R1721:Agrn	UTSW	4	156175173	nonsense	probably null
R1765:Agrn	UTSW	4	156176827	nonsense	probably null
R1840:Agrn	UTSW	4	156167415	missense	probably damaging	1.00
R1865:Agrn	UTSW	4	156166519	frame shift	probably null
R2105:Agrn	UTSW	4	156177299	nonsense	probably null
R2265:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2266:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2269:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2382:Agrn	UTSW	4	156176516	missense	probably damaging	0.97
R2497:Agrn	UTSW	4	156173811	missense	probably benign	0.28
R2509:Agrn	UTSW	4	156166424	splice site	probably null
R2510:Agrn	UTSW	4	156166424	splice site	probably null
R2511:Agrn	UTSW	4	156166424	splice site	probably null
R2994:Agrn	UTSW	4	156167328	missense	possibly damaging	0.79
R3824:Agrn	UTSW	4	156169302	missense	probably damaging	1.00
R4736:Agrn	UTSW	4	156172401	missense	probably benign	0.38
R4755:Agrn	UTSW	4	156173522	intron	probably benign
R4853:Agrn	UTSW	4	156185550	critical splice donor site	probably null
R4878:Agrn	UTSW	4	156170845	missense	probably damaging	1.00
R5117:Agrn	UTSW	4	156185553	missense	probably benign	0.30
R5228:Agrn	UTSW	4	156166946	missense	probably damaging	1.00
R5236:Agrn	UTSW	4	156178858	missense	possibly damaging	0.93
R5269:Agrn	UTSW	4	156168990	missense	probably benign	0.10
R5282:Agrn	UTSW	4	156173035	missense	probably damaging	1.00
R5449:Agrn	UTSW	4	156167280	critical splice donor site	probably null
R5560:Agrn	UTSW	4	156178497	missense	probably damaging	0.99
R5668:Agrn	UTSW	4	156167313	missense	probably damaging	0.97
R5725:Agrn	UTSW	4	156173875	missense	probably benign	0.25
R5967:Agrn	UTSW	4	156175103	missense	probably damaging	1.00
R6226:Agrn	UTSW	4	156173609	missense	probably damaging	0.96
R6338:Agrn	UTSW	4	156170585	missense	probably benign	0.17
R6351:Agrn	UTSW	4	156179434	missense	probably benign	0.00
R6437:Agrn	UTSW	4	156176778	missense	probably damaging	0.96
R6490:Agrn	UTSW	4	156167362	nonsense	probably null
R6909:Agrn	UTSW	4	156177007	missense	possibly damaging	0.90
R7123:Agrn	UTSW	4	156172840	missense	probably benign
R7163:Agrn	UTSW	4	156178509	missense	probably damaging	1.00
R7180:Agrn	UTSW	4	156171839	missense	probably benign	0.00
R7251:Agrn	UTSW	4	156174606	missense	probably damaging	1.00
R7289:Agrn	UTSW	4	156178932	missense	probably damaging	1.00
R7335:Agrn	UTSW	4	156176532	missense	probably damaging	1.00
R7336:Agrn	UTSW	4	156174914	nonsense	probably null
R7406:Agrn	UTSW	4	156172301	missense	possibly damaging	0.93
R7460:Agrn	UTSW	4	156174424	missense	probably damaging	0.98
R7531:Agrn	UTSW	4	156169804	missense	probably damaging	1.00
R7585:Agrn	UTSW	4	156170674	missense	probably benign	0.08
R7646:Agrn	UTSW	4	156195354	missense	probably damaging	0.99
R7652:Agrn	UTSW	4	156169218	critical splice donor site	probably null
R7714:Agrn	UTSW	4	156195397	missense	probably damaging	1.00
R7751:Agrn	UTSW	4	156176429	missense	probably damaging	1.00
R7852:Agrn	UTSW	4	156169057	missense	probably benign	0.01
R7927:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
R8039:Agrn	UTSW	4	156169011	missense	probably benign	0.12
R8056:Agrn	UTSW	4	156170411	missense	probably benign
R8061:Agrn	UTSW	4	156178954	missense	probably damaging	1.00
R8158:Agrn	UTSW	4	156173889	missense	probably benign
R8159:Agrn	UTSW	4	156172368	missense	probably benign	0.27
R8325:Agrn	UTSW	4	156173662	missense	probably benign	0.01
R8338:Agrn	UTSW	4	156168561	missense	probably benign	0.01
R8739:Agrn	UTSW	4	156172588	missense	probably benign
R8956:Agrn	UTSW	4	156166538	missense	probably damaging	0.99
R9094:Agrn	UTSW	4	156168807	missense	probably benign	0.01
R9112:Agrn	UTSW	4	156177057	missense	probably damaging	1.00
R9384:Agrn	UTSW	4	156172649	missense	probably damaging	1.00
R9472:Agrn	UTSW	4	156170384	missense
R9619:Agrn	UTSW	4	156174033	missense	probably benign	0.00
R9629:Agrn	UTSW	4	156172637	nonsense	probably null
R9732:Agrn	UTSW	4	156173989	missense	probably benign	0.13
R9749:Agrn	UTSW	4	156173657	missense	probably benign	0.02
R9757:Agrn	UTSW	4	156176778	missense	probably benign	0.03
R9792:Agrn	UTSW	4	156176672	missense	probably benign	0.09
R9793:Agrn	UTSW	4	156176672	missense	probably benign	0.09
Z1177:Agrn	UTSW	4	156171544	nonsense	probably null
Z1177:Agrn	UTSW	4	156179576	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CCATGTACAGTGTACTTGTGGG -3'
(R):5'- AAAACACCCTGCATGGCTTG -3'

Sequencing Primer
(F):5'- TTGTGGGGATTCAAGTATGCAGAAAC -3'
(R):5'- ACACGTGACTCTTCAGTGTG -3'

Posted On

2019-05-15