Incidental Mutation 'R7110:Pdgfra'
ID551440
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7110 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75189234 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 926 (Y926*)
Ref Sequence ENSEMBL: ENSMUSP00000000476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably null
Transcript: ENSMUST00000000476
AA Change: Y926*
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: Y926*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168162
AA Change: Y926*
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: Y926*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,745 T184A possibly damaging Het
Abca4 T A 3: 122,132,643 Y1243N probably damaging Het
Adamts7 A G 9: 90,193,964 T1250A possibly damaging Het
Adgrg3 T C 8: 95,034,963 V118A possibly damaging Het
Agrn A G 4: 156,178,875 V364A possibly damaging Het
Cacna2d1 C A 5: 16,357,784 L853I probably damaging Het
Ccdc25 A G 14: 65,856,716 K124R probably benign Het
Ccdc73 A G 2: 104,973,224 M236V probably benign Het
Cdh1 G A 8: 106,668,544 D862N possibly damaging Het
Cdh5 A G 8: 104,140,768 D559G probably damaging Het
Celsr2 C A 3: 108,397,865 G2133C probably damaging Het
Chd5 A G 4: 152,385,439 N1823S probably damaging Het
Cog7 T C 7: 121,935,776 N562S probably damaging Het
Dcaf6 A T 1: 165,351,968 S534R probably benign Het
Donson G A 16: 91,682,121 R436* probably null Het
Fam53c T A 18: 34,762,470 probably null Het
Foxi3 A G 6: 70,960,746 T321A probably benign Het
Frmd4b A T 6: 97,296,231 Y733* probably null Het
Fscn2 A T 11: 120,366,754 T314S probably benign Het
Gfral A G 9: 76,164,830 I386T possibly damaging Het
Gm21698 T C 5: 25,985,177 E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm9573 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,622,618 probably benign Het
Gprin1 T C 13: 54,739,243 D406G probably benign Het
Habp2 A T 19: 56,311,164 R128* probably null Het
Hoxc10 A T 15: 102,970,921 Y292F probably damaging Het
Hydin A T 8: 110,354,951 probably null Het
Igkv12-89 T C 6: 68,835,131 D18G probably damaging Het
Jhy T C 9: 40,917,260 N450S probably damaging Het
Klhl18 T A 9: 110,450,765 Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lsmem1 A T 12: 40,185,273 probably null Het
Ly75 A G 2: 60,376,184 I47T probably benign Het
Med12l C A 3: 59,262,224 T1603K possibly damaging Het
Mgat5 A G 1: 127,382,979 D210G possibly damaging Het
Mgmt G T 7: 137,085,986 G55W probably damaging Het
Mrpl57 G A 14: 57,826,297 probably benign Het
Mtg1 G A 7: 140,146,866 R209Q probably benign Het
Muc5ac T G 7: 141,799,822 C826W possibly damaging Het
Myot A G 18: 44,341,386 D146G probably damaging Het
Nlrp4f T A 13: 65,199,346 I11F probably damaging Het
Nsun5 T A 5: 135,371,250 Y76N probably damaging Het
Olfr8 A T 10: 78,955,450 M82L possibly damaging Het
Pcdhb3 A G 18: 37,302,922 N647S possibly damaging Het
Pdzd2 A T 15: 12,368,013 L2630H probably damaging Het
Phox2b G A 5: 67,096,162 S297L unknown Het
Polr3e T A 7: 120,940,287 probably null Het
Ppp4r2 T A 6: 100,865,862 V238E probably damaging Het
Proc A T 18: 32,133,388 F129I probably benign Het
Sgca T A 11: 94,963,401 probably null Het
Slc7a10 A G 7: 35,199,584 H360R probably benign Het
Slurp2 G A 15: 74,743,115 T59I probably benign Het
Son A G 16: 91,656,518 T718A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spink7 T C 18: 62,594,267 N62S probably damaging Het
Stxbp3 C A 3: 108,816,333 R195S probably damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Tbc1d9b A T 11: 50,163,830 I934F probably benign Het
Tecpr2 T G 12: 110,918,972 L195R probably damaging Het
Tns2 G C 15: 102,105,366 C71S probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp40 G T 1: 87,986,162 T403K probably benign Het
Vat1 G T 11: 101,465,713 R141S possibly damaging Het
Vmn2r28 T G 7: 5,490,734 N71T probably benign Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
Pony_express UTSW 5 75189234 nonsense probably null
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
R7347:Pdgfra UTSW 5 75183098 missense possibly damaging 0.91
R7476:Pdgfra UTSW 5 75170603 missense probably damaging 1.00
R7512:Pdgfra UTSW 5 75195014 nonsense probably null
R7609:Pdgfra UTSW 5 75166721 missense probably benign 0.10
R7925:Pdgfra UTSW 5 75192418 splice site probably benign
R8141:Pdgfra UTSW 5 75177726 missense possibly damaging 0.81
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Z1177:Pdgfra UTSW 5 75181674 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGATGGTCGATTCTAC -3'
(R):5'- GCGTTCCTTTCAAACAGCTC -3'

Sequencing Primer
(F):5'- GCATGATGGTCGATTCTACTTTCTAC -3'
(R):5'- GTTCCTTTCAAACAGCTCAGAGC -3'
Posted On2019-05-15