Incidental Mutation 'R7110:Olfr8'
ID551460
Institutional Source Beutler Lab
Gene Symbol Olfr8
Ensembl Gene ENSMUSG00000094080
Gene Nameolfactory receptor 8
SynonymsMOR139-5P, GA_x6K02T2QGN0-2857086-2856154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R7110 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78950636-78958378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78955450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 82 (M82L)
Ref Sequence ENSEMBL: ENSMUSP00000144916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081571
AA Change: M82L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: M82L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203851
AA Change: M82L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: M82L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214952
AA Change: M82L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,745 T184A possibly damaging Het
Abca4 T A 3: 122,132,643 Y1243N probably damaging Het
Adamts7 A G 9: 90,193,964 T1250A possibly damaging Het
Adgrg3 T C 8: 95,034,963 V118A possibly damaging Het
Agrn A G 4: 156,178,875 V364A possibly damaging Het
Cacna2d1 C A 5: 16,357,784 L853I probably damaging Het
Ccdc25 A G 14: 65,856,716 K124R probably benign Het
Ccdc73 A G 2: 104,973,224 M236V probably benign Het
Cdh1 G A 8: 106,668,544 D862N possibly damaging Het
Cdh5 A G 8: 104,140,768 D559G probably damaging Het
Celsr2 C A 3: 108,397,865 G2133C probably damaging Het
Chd5 A G 4: 152,385,439 N1823S probably damaging Het
Cog7 T C 7: 121,935,776 N562S probably damaging Het
Dcaf6 A T 1: 165,351,968 S534R probably benign Het
Donson G A 16: 91,682,121 R436* probably null Het
Fam53c T A 18: 34,762,470 probably null Het
Foxi3 A G 6: 70,960,746 T321A probably benign Het
Frmd4b A T 6: 97,296,231 Y733* probably null Het
Fscn2 A T 11: 120,366,754 T314S probably benign Het
Gfral A G 9: 76,164,830 I386T possibly damaging Het
Gm21698 T C 5: 25,985,177 E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm9573 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,622,618 probably benign Het
Gprin1 T C 13: 54,739,243 D406G probably benign Het
Habp2 A T 19: 56,311,164 R128* probably null Het
Hoxc10 A T 15: 102,970,921 Y292F probably damaging Het
Hydin A T 8: 110,354,951 probably null Het
Igkv12-89 T C 6: 68,835,131 D18G probably damaging Het
Jhy T C 9: 40,917,260 N450S probably damaging Het
Klhl18 T A 9: 110,450,765 Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lsmem1 A T 12: 40,185,273 probably null Het
Ly75 A G 2: 60,376,184 I47T probably benign Het
Med12l C A 3: 59,262,224 T1603K possibly damaging Het
Mgat5 A G 1: 127,382,979 D210G possibly damaging Het
Mgmt G T 7: 137,085,986 G55W probably damaging Het
Mrpl57 G A 14: 57,826,297 probably benign Het
Mtg1 G A 7: 140,146,866 R209Q probably benign Het
Muc5ac T G 7: 141,799,822 C826W possibly damaging Het
Myot A G 18: 44,341,386 D146G probably damaging Het
Nlrp4f T A 13: 65,199,346 I11F probably damaging Het
Nsun5 T A 5: 135,371,250 Y76N probably damaging Het
Pcdhb3 A G 18: 37,302,922 N647S possibly damaging Het
Pdgfra T A 5: 75,189,234 Y926* probably null Het
Pdzd2 A T 15: 12,368,013 L2630H probably damaging Het
Phox2b G A 5: 67,096,162 S297L unknown Het
Polr3e T A 7: 120,940,287 probably null Het
Ppp4r2 T A 6: 100,865,862 V238E probably damaging Het
Proc A T 18: 32,133,388 F129I probably benign Het
Sgca T A 11: 94,963,401 probably null Het
Slc7a10 A G 7: 35,199,584 H360R probably benign Het
Slurp2 G A 15: 74,743,115 T59I probably benign Het
Son A G 16: 91,656,518 T718A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spink7 T C 18: 62,594,267 N62S probably damaging Het
Stxbp3 C A 3: 108,816,333 R195S probably damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Tbc1d9b A T 11: 50,163,830 I934F probably benign Het
Tecpr2 T G 12: 110,918,972 L195R probably damaging Het
Tns2 G C 15: 102,105,366 C71S probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp40 G T 1: 87,986,162 T403K probably benign Het
Vat1 G T 11: 101,465,713 R141S possibly damaging Het
Vmn2r28 T G 7: 5,490,734 N71T probably benign Het
Other mutations in Olfr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr8 APN 10 78955354 missense possibly damaging 0.48
IGL01480:Olfr8 APN 10 78956144 utr 3 prime probably benign
IGL02505:Olfr8 APN 10 78955933 missense probably benign 0.02
IGL02543:Olfr8 APN 10 78955939 missense probably damaging 1.00
IGL03323:Olfr8 APN 10 78955600 missense probably benign
PIT4466001:Olfr8 UTSW 10 78955842 missense probably benign 0.00
R1496:Olfr8 UTSW 10 78955848 missense probably benign 0.41
R1754:Olfr8 UTSW 10 78955697 missense probably damaging 0.99
R1878:Olfr8 UTSW 10 78955805 missense possibly damaging 0.62
R2760:Olfr8 UTSW 10 78956042 missense probably damaging 0.99
R4202:Olfr8 UTSW 10 78955295 missense probably benign
R4206:Olfr8 UTSW 10 78955283 missense probably benign 0.00
R4517:Olfr8 UTSW 10 78956043 nonsense probably null
R4613:Olfr8 UTSW 10 78956065 missense probably damaging 1.00
R4799:Olfr8 UTSW 10 78956097 missense probably null 0.92
R4979:Olfr8 UTSW 10 78955932 nonsense probably null
R5008:Olfr8 UTSW 10 78956071 missense probably damaging 1.00
R5700:Olfr8 UTSW 10 78955484 missense probably damaging 1.00
R5876:Olfr8 UTSW 10 78955357 missense probably benign 0.15
R6439:Olfr8 UTSW 10 78955984 missense probably damaging 1.00
R6930:Olfr8 UTSW 10 78955781 missense possibly damaging 0.84
R7405:Olfr8 UTSW 10 78955697 missense probably benign 0.14
R7524:Olfr8 UTSW 10 78955491 nonsense probably null
Z1176:Olfr8 UTSW 10 78955219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATTTTCAGAAAACCCACACC -3'
(R):5'- GGATGCTAACAACCCAGGACAG -3'

Sequencing Primer
(F):5'- TTTCAGAAAACCCACACCTTCAATTC -3'
(R):5'- ACCATCAGTATACAGAGATGTTGG -3'
Posted On2019-05-15