Incidental Mutation 'R0597:Muc19'
ID55147
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Namemucin 19
Synonymsapomucin, sld
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91838326-91934555 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 91900502 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91886749 exon noncoding transcript
IGL01017:Muc19 APN 15 91880707 exon noncoding transcript
IGL01140:Muc19 APN 15 91899399 exon noncoding transcript
IGL01292:Muc19 APN 15 91894276 exon noncoding transcript
IGL01397:Muc19 APN 15 91894304 exon noncoding transcript
IGL01525:Muc19 APN 15 91886683 exon noncoding transcript
IGL01589:Muc19 APN 15 91870501 exon noncoding transcript
IGL02023:Muc19 APN 15 91888259 exon noncoding transcript
IGL02088:Muc19 APN 15 91891168 splice site noncoding transcript
IGL02168:Muc19 APN 15 91894098 exon noncoding transcript
IGL02343:Muc19 APN 15 91894234 exon noncoding transcript
IGL02402:Muc19 APN 15 91893998 splice site noncoding transcript
IGL02433:Muc19 APN 15 91872496 exon noncoding transcript
IGL02533:Muc19 APN 15 91898047 exon noncoding transcript
IGL02558:Muc19 APN 15 91897622 exon noncoding transcript
IGL02652:Muc19 APN 15 91877815 critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91910539 unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91882656 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0208:Muc19 UTSW 15 91893024 splice site noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1469:Muc19 UTSW 15 91874300 unclassified noncoding transcript
R1942:Muc19 UTSW 15 91892472 exon noncoding transcript
R2035:Muc19 UTSW 15 91892405 splice site noncoding transcript
R2208:Muc19 UTSW 15 91871549 exon noncoding transcript
R2877:Muc19 UTSW 15 91893006 exon noncoding transcript
R2897:Muc19 UTSW 15 91924665 critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91897622 exon noncoding transcript
R4403:Muc19 UTSW 15 91871570 exon noncoding transcript
R4606:Muc19 UTSW 15 91934383 exon noncoding transcript
R4677:Muc19 UTSW 15 91888217 exon noncoding transcript
R4753:Muc19 UTSW 15 91877761 unclassified noncoding transcript
R4781:Muc19 UTSW 15 91903166 critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91897716 exon noncoding transcript
R5000:Muc19 UTSW 15 91873231 unclassified noncoding transcript
R5044:Muc19 UTSW 15 91888138 exon noncoding transcript
R5156:Muc19 UTSW 15 91900420 exon noncoding transcript
R5176:Muc19 UTSW 15 91892180 exon noncoding transcript
R5224:Muc19 UTSW 15 91928025 exon noncoding transcript
R5524:Muc19 UTSW 15 91894393 exon noncoding transcript
R5568:Muc19 UTSW 15 91884274 splice site noncoding transcript
R5592:Muc19 UTSW 15 91930314 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGCTAAGTGTCCAGAAAATGCACCC -3'
(R):5'- ACGAATTGAACGCTAATTGCCTCCC -3'

Sequencing Primer
(F):5'- ATGCACCCTATCTGGACGAG -3'
(R):5'- TGCAAACCATTCAGTAGTTGTG -3'
Posted On2013-07-11