Incidental Mutation 'R7110:Tulp4'
ID 551478
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Name tubby like protein 4
Synonyms 2210038L17Rik, 1110057P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Stock # R7110 (G1)
Quality Score 187.009
Status Not validated
Chromosome 17
Chromosomal Location 6106437-6251128 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6231780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 695 (H695Y)
Ref Sequence ENSEMBL: ENSMUSP00000049248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000149756]
AlphaFold Q9JIL5
Predicted Effect probably damaging
Transcript: ENSMUST00000039655
AA Change: H695Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: H695Y

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137063
SMART Domains Protein: ENSMUSP00000123119
Gene: ENSMUSG00000034377

DomainStartEndE-ValueType
low complexity region 37 42 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
low complexity region 190 197 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Pfam:Tub 345 537 3.3e-11 PFAM
low complexity region 603 639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141059
Predicted Effect possibly damaging
Transcript: ENSMUST00000149756
AA Change: H502Y

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: H502Y

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,745 T184A possibly damaging Het
Abca4 T A 3: 122,132,643 Y1243N probably damaging Het
Adamts7 A G 9: 90,193,964 T1250A possibly damaging Het
Adgrg3 T C 8: 95,034,963 V118A possibly damaging Het
Agrn A G 4: 156,178,875 V364A possibly damaging Het
Cacna2d1 C A 5: 16,357,784 L853I probably damaging Het
Ccdc25 A G 14: 65,856,716 K124R probably benign Het
Ccdc73 A G 2: 104,973,224 M236V probably benign Het
Cdh1 G A 8: 106,668,544 D862N possibly damaging Het
Cdh5 A G 8: 104,140,768 D559G probably damaging Het
Celsr2 C A 3: 108,397,865 G2133C probably damaging Het
Chd5 A G 4: 152,385,439 N1823S probably damaging Het
Cog7 T C 7: 121,935,776 N562S probably damaging Het
Dcaf6 A T 1: 165,351,968 S534R probably benign Het
Donson G A 16: 91,682,121 R436* probably null Het
Fam53c T A 18: 34,762,470 probably null Het
Foxi3 A G 6: 70,960,746 T321A probably benign Het
Frmd4b A T 6: 97,296,231 Y733* probably null Het
Fscn2 A T 11: 120,366,754 T314S probably benign Het
Gfral A G 9: 76,164,830 I386T possibly damaging Het
Gm21698 T C 5: 25,985,177 E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm9573 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,622,618 probably benign Het
Gprin1 T C 13: 54,739,243 D406G probably benign Het
Habp2 A T 19: 56,311,164 R128* probably null Het
Hoxc10 A T 15: 102,970,921 Y292F probably damaging Het
Hydin A T 8: 110,354,951 probably null Het
Igkv12-89 T C 6: 68,835,131 D18G probably damaging Het
Jhy T C 9: 40,917,260 N450S probably damaging Het
Klhl18 T A 9: 110,450,765 Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lsmem1 A T 12: 40,185,273 probably null Het
Ly75 A G 2: 60,376,184 I47T probably benign Het
Med12l C A 3: 59,262,224 T1603K possibly damaging Het
Mgat5 A G 1: 127,382,979 D210G possibly damaging Het
Mgmt G T 7: 137,085,986 G55W probably damaging Het
Mrpl57 G A 14: 57,826,297 probably benign Het
Mtg1 G A 7: 140,146,866 R209Q probably benign Het
Muc5ac T G 7: 141,799,822 C826W possibly damaging Het
Myot A G 18: 44,341,386 D146G probably damaging Het
Nlrp4f T A 13: 65,199,346 I11F probably damaging Het
Nsun5 T A 5: 135,371,250 Y76N probably damaging Het
Olfr8 A T 10: 78,955,450 M82L possibly damaging Het
Pcdhb3 A G 18: 37,302,922 N647S possibly damaging Het
Pdgfra T A 5: 75,189,234 Y926* probably null Het
Pdzd2 A T 15: 12,368,013 L2630H probably damaging Het
Phox2b G A 5: 67,096,162 S297L unknown Het
Polr3e T A 7: 120,940,287 probably null Het
Ppp4r2 T A 6: 100,865,862 V238E probably damaging Het
Proc A T 18: 32,133,388 F129I probably benign Het
Sgca T A 11: 94,963,401 probably null Het
Slc7a10 A G 7: 35,199,584 H360R probably benign Het
Slurp2 G A 15: 74,743,115 T59I probably benign Het
Son A G 16: 91,656,518 T718A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spink7 T C 18: 62,594,267 N62S probably damaging Het
Stxbp3 C A 3: 108,816,333 R195S probably damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Tbc1d9b A T 11: 50,163,830 I934F probably benign Het
Tecpr2 T G 12: 110,918,972 L195R probably damaging Het
Tns2 G C 15: 102,105,366 C71S probably damaging Het
Usp40 G T 1: 87,986,162 T403K probably benign Het
Vat1 G T 11: 101,465,713 R141S possibly damaging Het
Vmn2r28 T G 7: 5,490,734 N71T probably benign Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6139076 missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6213391 missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6213379 splice site probably benign
IGL03219:Tulp4 APN 17 6139010 missense probably damaging 1.00
tuba_mirum UTSW 17 6201819 missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6222440 missense probably benign 0.39
R1736:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R1775:Tulp4 UTSW 17 6139046 missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3162:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6206964 missense probably benign 0.03
R4081:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6198833 missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6236293 missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6198736 missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6201819 missense probably damaging 1.00
R6587:Tulp4 UTSW 17 6231871 missense possibly damaging 0.62
R6680:Tulp4 UTSW 17 6139037 missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6214666 missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6185289 missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6236235 missense probably benign 0.03
R7438:Tulp4 UTSW 17 6198708 missense probably benign 0.42
R7750:Tulp4 UTSW 17 6233124 missense probably damaging 1.00
R8312:Tulp4 UTSW 17 6207058 critical splice donor site probably null
R8772:Tulp4 UTSW 17 6176893 missense probably damaging 1.00
R8821:Tulp4 UTSW 17 6139134 missense probably damaging 0.99
R8849:Tulp4 UTSW 17 6222381 missense probably benign 0.13
R9027:Tulp4 UTSW 17 6233197 missense possibly damaging 0.88
X0067:Tulp4 UTSW 17 6206923 missense possibly damaging 0.93
Z1177:Tulp4 UTSW 17 6224205 frame shift probably null
Predicted Primers
Posted On 2019-05-15