Incidental Mutation 'R7110:Tulp4'
ID 551478
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Name tubby like protein 4
Synonyms 2210038L17Rik, 1110057P05Rik
MMRRC Submission 045202-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R7110 (G1)
Quality Score 187.009
Status Not validated
Chromosome 17
Chromosomal Location 6156528-6290912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6282055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 695 (H695Y)
Ref Sequence ENSEMBL: ENSMUSP00000049248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000149756]
AlphaFold Q9JIL5
Predicted Effect probably damaging
Transcript: ENSMUST00000039655
AA Change: H695Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: H695Y

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137063
SMART Domains Protein: ENSMUSP00000123119
Gene: ENSMUSG00000034377

DomainStartEndE-ValueType
low complexity region 37 42 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
low complexity region 190 197 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Pfam:Tub 345 537 3.3e-11 PFAM
low complexity region 603 639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141059
Predicted Effect possibly damaging
Transcript: ENSMUST00000149756
AA Change: H502Y

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: H502Y

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,316,571 (GRCm39) T184A possibly damaging Het
Abca4 T A 3: 121,926,292 (GRCm39) Y1243N probably damaging Het
Adamts7 A G 9: 90,076,017 (GRCm39) T1250A possibly damaging Het
Adgrg3 T C 8: 95,761,591 (GRCm39) V118A possibly damaging Het
Agrn A G 4: 156,263,332 (GRCm39) V364A possibly damaging Het
Cacna2d1 C A 5: 16,562,782 (GRCm39) L853I probably damaging Het
Ccdc25 A G 14: 66,094,165 (GRCm39) K124R probably benign Het
Ccdc73 A G 2: 104,803,569 (GRCm39) M236V probably benign Het
Cdh1 G A 8: 107,395,176 (GRCm39) D862N possibly damaging Het
Cdh5 A G 8: 104,867,400 (GRCm39) D559G probably damaging Het
Celsr2 C A 3: 108,305,181 (GRCm39) G2133C probably damaging Het
Chd5 A G 4: 152,469,896 (GRCm39) N1823S probably damaging Het
Cog7 T C 7: 121,534,999 (GRCm39) N562S probably damaging Het
Dcaf6 A T 1: 165,179,537 (GRCm39) S534R probably benign Het
Donson G A 16: 91,479,009 (GRCm39) R436* probably null Het
Fam53c T A 18: 34,895,523 (GRCm39) probably null Het
Foxi3 A G 6: 70,937,730 (GRCm39) T321A probably benign Het
Frmd4b A T 6: 97,273,192 (GRCm39) Y733* probably null Het
Fscn2 A T 11: 120,257,580 (GRCm39) T314S probably benign Het
Gfral A G 9: 76,072,112 (GRCm39) I386T possibly damaging Het
Gm21698 T C 5: 26,190,175 (GRCm39) E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gprin1 T C 13: 54,887,056 (GRCm39) D406G probably benign Het
Habp2 A T 19: 56,299,596 (GRCm39) R128* probably null Het
Hoxc10 A T 15: 102,879,356 (GRCm39) Y292F probably damaging Het
Hydin A T 8: 111,081,583 (GRCm39) probably null Het
Igkv12-89 T C 6: 68,812,115 (GRCm39) D18G probably damaging Het
Jhy T C 9: 40,828,556 (GRCm39) N450S probably damaging Het
Klhl18 T A 9: 110,279,833 (GRCm39) Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lsmem1 A T 12: 40,235,272 (GRCm39) probably null Het
Ly75 A G 2: 60,206,528 (GRCm39) I47T probably benign Het
Med12l C A 3: 59,169,645 (GRCm39) T1603K possibly damaging Het
Mgat5 A G 1: 127,310,716 (GRCm39) D210G possibly damaging Het
Mgmt G T 7: 136,687,715 (GRCm39) G55W probably damaging Het
Mrpl57 G A 14: 58,063,754 (GRCm39) probably benign Het
Mtg1 G A 7: 139,726,779 (GRCm39) R209Q probably benign Het
Muc21 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,933,510 (GRCm39) probably benign Het
Muc5ac T G 7: 141,353,559 (GRCm39) C826W possibly damaging Het
Myot A G 18: 44,474,453 (GRCm39) D146G probably damaging Het
Nlrp4f T A 13: 65,347,160 (GRCm39) I11F probably damaging Het
Nsun5 T A 5: 135,400,104 (GRCm39) Y76N probably damaging Het
Or7a42 A T 10: 78,791,284 (GRCm39) M82L possibly damaging Het
Pcdhb3 A G 18: 37,435,975 (GRCm39) N647S possibly damaging Het
Pdgfra T A 5: 75,349,895 (GRCm39) Y926* probably null Het
Pdzd2 A T 15: 12,368,099 (GRCm39) L2630H probably damaging Het
Phox2b G A 5: 67,253,505 (GRCm39) S297L unknown Het
Polr3e T A 7: 120,539,510 (GRCm39) probably null Het
Ppp4r2 T A 6: 100,842,823 (GRCm39) V238E probably damaging Het
Proc A T 18: 32,266,441 (GRCm39) F129I probably benign Het
Sgca T A 11: 94,854,227 (GRCm39) probably null Het
Slc7a10 A G 7: 34,899,009 (GRCm39) H360R probably benign Het
Slurp2 G A 15: 74,614,964 (GRCm39) T59I probably benign Het
Son A G 16: 91,453,406 (GRCm39) T718A probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spink7 T C 18: 62,727,338 (GRCm39) N62S probably damaging Het
Stxbp3 C A 3: 108,723,649 (GRCm39) R195S probably damaging Het
Sulf1 G A 1: 12,908,825 (GRCm39) V613M probably damaging Het
Tbc1d9b A T 11: 50,054,657 (GRCm39) I934F probably benign Het
Tecpr2 T G 12: 110,885,406 (GRCm39) L195R probably damaging Het
Tns2 G C 15: 102,013,801 (GRCm39) C71S probably damaging Het
Usp40 G T 1: 87,913,884 (GRCm39) T403K probably benign Het
Vat1 G T 11: 101,356,539 (GRCm39) R141S possibly damaging Het
Vmn2r28 T G 7: 5,493,733 (GRCm39) N71T probably benign Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6,189,351 (GRCm39) missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6,263,666 (GRCm39) missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6,263,654 (GRCm39) splice site probably benign
IGL03219:Tulp4 APN 17 6,189,285 (GRCm39) missense probably damaging 1.00
tuba_mirum UTSW 17 6,252,094 (GRCm39) missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6,252,008 (GRCm39) missense probably damaging 0.99
R0066:Tulp4 UTSW 17 6,252,008 (GRCm39) missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6,189,387 (GRCm39) missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6,272,715 (GRCm39) missense probably benign 0.39
R1736:Tulp4 UTSW 17 6,283,490 (GRCm39) missense possibly damaging 0.66
R1775:Tulp4 UTSW 17 6,189,321 (GRCm39) missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6,189,387 (GRCm39) missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6,248,983 (GRCm39) start codon destroyed probably null 0.94
R3162:Tulp4 UTSW 17 6,248,983 (GRCm39) start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6,257,239 (GRCm39) missense probably benign 0.03
R4081:Tulp4 UTSW 17 6,282,055 (GRCm39) missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6,282,055 (GRCm39) missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6,249,108 (GRCm39) missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6,249,088 (GRCm39) missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6,249,088 (GRCm39) missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6,286,568 (GRCm39) missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6,283,490 (GRCm39) missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6,249,011 (GRCm39) missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6,252,094 (GRCm39) missense probably damaging 1.00
R6587:Tulp4 UTSW 17 6,282,146 (GRCm39) missense possibly damaging 0.62
R6680:Tulp4 UTSW 17 6,189,312 (GRCm39) missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6,264,941 (GRCm39) missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6,235,564 (GRCm39) missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6,282,055 (GRCm39) missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6,282,055 (GRCm39) missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6,282,055 (GRCm39) missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6,286,510 (GRCm39) missense probably benign 0.03
R7438:Tulp4 UTSW 17 6,248,983 (GRCm39) missense probably benign 0.42
R7750:Tulp4 UTSW 17 6,283,399 (GRCm39) missense probably damaging 1.00
R8312:Tulp4 UTSW 17 6,257,333 (GRCm39) critical splice donor site probably null
R8772:Tulp4 UTSW 17 6,227,168 (GRCm39) missense probably damaging 1.00
R8821:Tulp4 UTSW 17 6,189,409 (GRCm39) missense probably damaging 0.99
R8849:Tulp4 UTSW 17 6,272,656 (GRCm39) missense probably benign 0.13
R9027:Tulp4 UTSW 17 6,283,472 (GRCm39) missense possibly damaging 0.88
R9448:Tulp4 UTSW 17 6,248,948 (GRCm39) missense possibly damaging 0.91
R9681:Tulp4 UTSW 17 6,274,500 (GRCm39) missense possibly damaging 0.86
R9748:Tulp4 UTSW 17 6,291,480 (GRCm39) critical splice donor site probably null
X0067:Tulp4 UTSW 17 6,257,198 (GRCm39) missense possibly damaging 0.93
Z1177:Tulp4 UTSW 17 6,274,480 (GRCm39) frame shift probably null
Predicted Primers
Posted On 2019-05-15