Incidental Mutation 'R0597:Smarcd1'
ID55148
Institutional Source Beutler Lab
Gene Symbol Smarcd1
Ensembl Gene ENSMUSG00000023018
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
SynonymsD15Kz1, Baf60a
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R0597 (G1)
Quality Score173
Status Validated
Chromosome15
Chromosomal Location99702129-99713991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99711094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 383 (I383N)
Ref Sequence ENSEMBL: ENSMUSP00000155750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023759] [ENSMUST00000229236]
Predicted Effect probably damaging
Transcript: ENSMUST00000023759
AA Change: I424N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018
AA Change: I424N

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161529
Predicted Effect probably damaging
Transcript: ENSMUST00000229236
AA Change: I383N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230748
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Smarcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Smarcd1 APN 15 99712213 missense probably benign 0.10
IGL01714:Smarcd1 APN 15 99712421 missense probably damaging 1.00
IGL02488:Smarcd1 APN 15 99711201 missense possibly damaging 0.83
P0021:Smarcd1 UTSW 15 99712361 splice site probably benign
R0645:Smarcd1 UTSW 15 99707386 unclassified probably null
R1531:Smarcd1 UTSW 15 99707383 missense probably damaging 1.00
R1661:Smarcd1 UTSW 15 99707638 critical splice acceptor site probably null
R1857:Smarcd1 UTSW 15 99709414 missense probably damaging 0.97
R3003:Smarcd1 UTSW 15 99712184 missense probably damaging 1.00
R4170:Smarcd1 UTSW 15 99707931 missense probably damaging 1.00
R4964:Smarcd1 UTSW 15 99707981 missense possibly damaging 0.79
R5116:Smarcd1 UTSW 15 99702488 missense probably benign 0.00
R5358:Smarcd1 UTSW 15 99703247 nonsense probably null
R5559:Smarcd1 UTSW 15 99703295 critical splice donor site probably null
R6026:Smarcd1 UTSW 15 99705738 missense probably damaging 1.00
R6424:Smarcd1 UTSW 15 99704367 missense probably damaging 1.00
R6450:Smarcd1 UTSW 15 99707885 missense possibly damaging 0.85
R7126:Smarcd1 UTSW 15 99709325 missense probably damaging 1.00
X0026:Smarcd1 UTSW 15 99702449 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCTGGATAGAAGCAAGCACGC -3'
(R):5'- AACTCTAGCACGGACCCTGAGATG -3'

Sequencing Primer
(F):5'- AAGCACGCTGCTTTCTGAAG -3'
(R):5'- CTCTCTGCACAGGAGTAAAGTGAC -3'
Posted On2013-07-11