Incidental Mutation 'R7110:Pcdhb3'
ID 551481
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Name protocadherin beta 3
Synonyms PcdhbC
MMRRC Submission 045202-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7110 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37433852-37437638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37435975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 647 (N647S)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000051754
AA Change: N647S

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: N647S

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.2912 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,316,571 (GRCm39) T184A possibly damaging Het
Abca4 T A 3: 121,926,292 (GRCm39) Y1243N probably damaging Het
Adamts7 A G 9: 90,076,017 (GRCm39) T1250A possibly damaging Het
Adgrg3 T C 8: 95,761,591 (GRCm39) V118A possibly damaging Het
Agrn A G 4: 156,263,332 (GRCm39) V364A possibly damaging Het
Cacna2d1 C A 5: 16,562,782 (GRCm39) L853I probably damaging Het
Ccdc25 A G 14: 66,094,165 (GRCm39) K124R probably benign Het
Ccdc73 A G 2: 104,803,569 (GRCm39) M236V probably benign Het
Cdh1 G A 8: 107,395,176 (GRCm39) D862N possibly damaging Het
Cdh5 A G 8: 104,867,400 (GRCm39) D559G probably damaging Het
Celsr2 C A 3: 108,305,181 (GRCm39) G2133C probably damaging Het
Chd5 A G 4: 152,469,896 (GRCm39) N1823S probably damaging Het
Cog7 T C 7: 121,534,999 (GRCm39) N562S probably damaging Het
Dcaf6 A T 1: 165,179,537 (GRCm39) S534R probably benign Het
Donson G A 16: 91,479,009 (GRCm39) R436* probably null Het
Fam53c T A 18: 34,895,523 (GRCm39) probably null Het
Foxi3 A G 6: 70,937,730 (GRCm39) T321A probably benign Het
Frmd4b A T 6: 97,273,192 (GRCm39) Y733* probably null Het
Fscn2 A T 11: 120,257,580 (GRCm39) T314S probably benign Het
Gfral A G 9: 76,072,112 (GRCm39) I386T possibly damaging Het
Gm21698 T C 5: 26,190,175 (GRCm39) E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gprin1 T C 13: 54,887,056 (GRCm39) D406G probably benign Het
Habp2 A T 19: 56,299,596 (GRCm39) R128* probably null Het
Hoxc10 A T 15: 102,879,356 (GRCm39) Y292F probably damaging Het
Hydin A T 8: 111,081,583 (GRCm39) probably null Het
Igkv12-89 T C 6: 68,812,115 (GRCm39) D18G probably damaging Het
Jhy T C 9: 40,828,556 (GRCm39) N450S probably damaging Het
Klhl18 T A 9: 110,279,833 (GRCm39) Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lsmem1 A T 12: 40,235,272 (GRCm39) probably null Het
Ly75 A G 2: 60,206,528 (GRCm39) I47T probably benign Het
Med12l C A 3: 59,169,645 (GRCm39) T1603K possibly damaging Het
Mgat5 A G 1: 127,310,716 (GRCm39) D210G possibly damaging Het
Mgmt G T 7: 136,687,715 (GRCm39) G55W probably damaging Het
Mrpl57 G A 14: 58,063,754 (GRCm39) probably benign Het
Mtg1 G A 7: 139,726,779 (GRCm39) R209Q probably benign Het
Muc21 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,933,510 (GRCm39) probably benign Het
Muc5ac T G 7: 141,353,559 (GRCm39) C826W possibly damaging Het
Myot A G 18: 44,474,453 (GRCm39) D146G probably damaging Het
Nlrp4f T A 13: 65,347,160 (GRCm39) I11F probably damaging Het
Nsun5 T A 5: 135,400,104 (GRCm39) Y76N probably damaging Het
Or7a42 A T 10: 78,791,284 (GRCm39) M82L possibly damaging Het
Pdgfra T A 5: 75,349,895 (GRCm39) Y926* probably null Het
Pdzd2 A T 15: 12,368,099 (GRCm39) L2630H probably damaging Het
Phox2b G A 5: 67,253,505 (GRCm39) S297L unknown Het
Polr3e T A 7: 120,539,510 (GRCm39) probably null Het
Ppp4r2 T A 6: 100,842,823 (GRCm39) V238E probably damaging Het
Proc A T 18: 32,266,441 (GRCm39) F129I probably benign Het
Sgca T A 11: 94,854,227 (GRCm39) probably null Het
Slc7a10 A G 7: 34,899,009 (GRCm39) H360R probably benign Het
Slurp2 G A 15: 74,614,964 (GRCm39) T59I probably benign Het
Son A G 16: 91,453,406 (GRCm39) T718A probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spink7 T C 18: 62,727,338 (GRCm39) N62S probably damaging Het
Stxbp3 C A 3: 108,723,649 (GRCm39) R195S probably damaging Het
Sulf1 G A 1: 12,908,825 (GRCm39) V613M probably damaging Het
Tbc1d9b A T 11: 50,054,657 (GRCm39) I934F probably benign Het
Tecpr2 T G 12: 110,885,406 (GRCm39) L195R probably damaging Het
Tns2 G C 15: 102,013,801 (GRCm39) C71S probably damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp40 G T 1: 87,913,884 (GRCm39) T403K probably benign Het
Vat1 G T 11: 101,356,539 (GRCm39) R141S possibly damaging Het
Vmn2r28 T G 7: 5,493,733 (GRCm39) N71T probably benign Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37,436,001 (GRCm39) missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37,435,054 (GRCm39) missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37,435,198 (GRCm39) missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37,435,150 (GRCm39) missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37,434,272 (GRCm39) missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37,436,014 (GRCm39) missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37,435,210 (GRCm39) missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37,434,634 (GRCm39) missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37,436,375 (GRCm39) missense probably benign
R1728:Pcdhb3 UTSW 18 37,434,931 (GRCm39) missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37,434,931 (GRCm39) missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37,434,370 (GRCm39) missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37,436,362 (GRCm39) missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37,435,239 (GRCm39) missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37,434,294 (GRCm39) missense probably benign 0.17
R2513:Pcdhb3 UTSW 18 37,434,292 (GRCm39) nonsense probably null
R2513:Pcdhb3 UTSW 18 37,434,293 (GRCm39) missense probably damaging 1.00
R3080:Pcdhb3 UTSW 18 37,434,535 (GRCm39) missense probably damaging 1.00
R3755:Pcdhb3 UTSW 18 37,435,878 (GRCm39) missense probably damaging 0.97
R3756:Pcdhb3 UTSW 18 37,435,878 (GRCm39) missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37,436,329 (GRCm39) missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37,435,093 (GRCm39) missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37,434,759 (GRCm39) missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37,435,452 (GRCm39) missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37,434,179 (GRCm39) missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37,434,520 (GRCm39) missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37,434,700 (GRCm39) missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37,434,561 (GRCm39) missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37,435,706 (GRCm39) missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37,435,242 (GRCm39) missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37,434,699 (GRCm39) missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37,433,998 (GRCm39) intron probably benign
R6425:Pcdhb3 UTSW 18 37,435,528 (GRCm39) missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37,434,763 (GRCm39) missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37,434,265 (GRCm39) missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37,435,672 (GRCm39) missense probably damaging 1.00
R7236:Pcdhb3 UTSW 18 37,434,505 (GRCm39) missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37,434,657 (GRCm39) missense probably benign
R7469:Pcdhb3 UTSW 18 37,434,388 (GRCm39) missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37,435,565 (GRCm39) missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37,436,012 (GRCm39) missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37,434,974 (GRCm39) missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37,435,982 (GRCm39) missense probably benign
R8157:Pcdhb3 UTSW 18 37,436,292 (GRCm39) missense probably damaging 1.00
R9264:Pcdhb3 UTSW 18 37,435,166 (GRCm39) missense probably benign 0.03
R9482:Pcdhb3 UTSW 18 37,434,736 (GRCm39) missense probably damaging 1.00
R9488:Pcdhb3 UTSW 18 37,435,416 (GRCm39) missense possibly damaging 0.62
X0026:Pcdhb3 UTSW 18 37,434,817 (GRCm39) missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37,435,392 (GRCm39) nonsense probably null
Z1177:Pcdhb3 UTSW 18 37,435,089 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCAAGGTAGTGGCAGTG -3'
(R):5'- CACCCATAGAAGCTGCTCTG -3'

Sequencing Primer
(F):5'- TAGTGGCAGTGGACCGC -3'
(R):5'- ATAGAAGCTGCTCTGGCCCTC -3'
Posted On 2019-05-15