Incidental Mutation 'R7111:Sema4c'
ID551486
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
SynonymsSemaf, Semacl1, M-Sema F, Semacl1, Semai
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36548639-36558349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36553079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 229 (T229M)
Ref Sequence ENSEMBL: ENSMUSP00000110643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195339] [ENSMUST00000195620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114991
AA Change: T229M

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: T229M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191642
AA Change: T229M

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: T229M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191677
AA Change: T229M

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: T229M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000195339
Predicted Effect possibly damaging
Transcript: ENSMUST00000195620
AA Change: T229M

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: T229M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36553920 critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36553029 missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36553085 missense probably damaging 1.00
IGL02262:Sema4c APN 1 36550341 missense probably damaging 1.00
IGL02282:Sema4c APN 1 36550203 unclassified probably null
IGL02476:Sema4c APN 1 36555950 missense probably damaging 0.98
IGL02900:Sema4c APN 1 36550745 nonsense probably null
swirl UTSW 1 36550311 missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36552884 missense probably damaging 1.00
R0427:Sema4c UTSW 1 36553811 nonsense probably null
R0497:Sema4c UTSW 1 36549608 missense probably benign 0.04
R1066:Sema4c UTSW 1 36550200 missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36552110 missense probably damaging 1.00
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1639:Sema4c UTSW 1 36553534 missense probably benign 0.00
R1644:Sema4c UTSW 1 36550804 missense probably damaging 1.00
R3176:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36553723 missense probably benign 0.02
R4452:Sema4c UTSW 1 36553756 missense probably benign 0.31
R4883:Sema4c UTSW 1 36552016 missense probably damaging 0.98
R4895:Sema4c UTSW 1 36553570 splice site probably null
R4913:Sema4c UTSW 1 36550185 missense probably benign 0.11
R4944:Sema4c UTSW 1 36550311 missense probably damaging 1.00
R5062:Sema4c UTSW 1 36552978 critical splice donor site probably null
R5077:Sema4c UTSW 1 36551731 missense probably benign 0.20
R5109:Sema4c UTSW 1 36552300 frame shift probably null
R5208:Sema4c UTSW 1 36550326 missense probably damaging 1.00
R5551:Sema4c UTSW 1 36552317 missense probably damaging 1.00
R5912:Sema4c UTSW 1 36554388 missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36550753 missense probably benign 0.02
R7141:Sema4c UTSW 1 36553020 missense probably damaging 0.99
R7252:Sema4c UTSW 1 36550015 missense probably damaging 1.00
R7495:Sema4c UTSW 1 36550693 missense probably benign 0.00
R7891:Sema4c UTSW 1 36549914 missense probably damaging 0.98
R7895:Sema4c UTSW 1 36553118 missense probably damaging 1.00
R8264:Sema4c UTSW 1 36552885 missense probably damaging 1.00
X0019:Sema4c UTSW 1 36552996 missense probably damaging 1.00
X0028:Sema4c UTSW 1 36549966 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGAACGTCGTCCATTTCTTC -3'
(R):5'- ACAGAGCCGGTTATCCTTCG -3'

Sequencing Primer
(F):5'- ATGTCACCCTGGCAGATGG -3'
(R):5'- AGAGCCGGTTATCCTTCGATACATG -3'
Posted On2019-05-15