Incidental Mutation 'R7111:Ckap5'
ID551495
Institutional Source Beutler Lab
Gene Symbol Ckap5
Ensembl Gene ENSMUSG00000040549
Gene Namecytoskeleton associated protein 5
Synonyms4930432B04Rik, 3110043H24Rik, D730027C18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91526762-91620664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91607572 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1666 (R1666H)
Ref Sequence ENSEMBL: ENSMUSP00000097303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046769] [ENSMUST00000099716] [ENSMUST00000111337] [ENSMUST00000111338]
Predicted Effect probably damaging
Transcript: ENSMUST00000046769
AA Change: R1666H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046263
Gene: ENSMUSG00000040549
AA Change: R1666H

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1981 1994 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099716
AA Change: R1666H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097303
Gene: ENSMUSG00000040549
AA Change: R1666H

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111337
AA Change: R1606H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106969
Gene: ENSMUSG00000040549
AA Change: R1606H

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1625 1638 N/A INTRINSIC
low complexity region 1699 1711 N/A INTRINSIC
low complexity region 1849 1861 N/A INTRINSIC
low complexity region 1942 1955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111338
AA Change: R1666H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106970
Gene: ENSMUSG00000040549
AA Change: R1666H

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Ckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ckap5 APN 2 91606256 missense probably damaging 1.00
IGL00566:Ckap5 APN 2 91568627 splice site probably benign
IGL00585:Ckap5 APN 2 91619825 missense probably damaging 1.00
IGL00910:Ckap5 APN 2 91576050 missense probably benign 0.32
IGL01309:Ckap5 APN 2 91570184 missense probably damaging 0.99
IGL01411:Ckap5 APN 2 91601011 missense probably benign 0.26
IGL01654:Ckap5 APN 2 91577609 missense probably benign 0.26
IGL01684:Ckap5 APN 2 91555354 missense probably benign 0.06
IGL02031:Ckap5 APN 2 91612772 missense possibly damaging 0.85
IGL02057:Ckap5 APN 2 91600707 missense possibly damaging 0.91
IGL02101:Ckap5 APN 2 91572540 splice site probably benign
IGL02250:Ckap5 APN 2 91548901 missense probably damaging 1.00
IGL02556:Ckap5 APN 2 91594841 splice site probably benign
IGL02620:Ckap5 APN 2 91606369 missense probably benign 0.01
IGL02627:Ckap5 APN 2 91576021 missense probably damaging 1.00
IGL02693:Ckap5 APN 2 91570211 missense probably damaging 1.00
IGL02808:Ckap5 APN 2 91596514 missense probably damaging 1.00
IGL03086:Ckap5 APN 2 91570276 splice site probably benign
K7371:Ckap5 UTSW 2 91595523 splice site probably benign
R0106:Ckap5 UTSW 2 91578205 missense possibly damaging 0.90
R0106:Ckap5 UTSW 2 91615840 missense probably damaging 1.00
R0114:Ckap5 UTSW 2 91620112 missense possibly damaging 0.86
R0464:Ckap5 UTSW 2 91579513 missense probably benign 0.00
R0633:Ckap5 UTSW 2 91550743 missense probably damaging 0.96
R0723:Ckap5 UTSW 2 91555331 missense probably damaging 0.99
R1037:Ckap5 UTSW 2 91550629 missense probably benign 0.00
R1139:Ckap5 UTSW 2 91581143 missense probably benign 0.11
R1161:Ckap5 UTSW 2 91599375 missense probably null 1.00
R1183:Ckap5 UTSW 2 91586266 missense probably benign 0.01
R1660:Ckap5 UTSW 2 91562958 missense possibly damaging 0.92
R1850:Ckap5 UTSW 2 91595713 missense probably damaging 1.00
R1951:Ckap5 UTSW 2 91556492 splice site probably benign
R1968:Ckap5 UTSW 2 91586343 missense probably benign 0.10
R2004:Ckap5 UTSW 2 91607546 missense possibly damaging 0.91
R2143:Ckap5 UTSW 2 91565745 missense probably benign 0.00
R2391:Ckap5 UTSW 2 91585869 missense possibly damaging 0.66
R2435:Ckap5 UTSW 2 91581145 missense probably benign 0.01
R2438:Ckap5 UTSW 2 91595408 missense possibly damaging 0.95
R2680:Ckap5 UTSW 2 91588698 missense probably benign
R2698:Ckap5 UTSW 2 91578081 missense probably damaging 1.00
R3420:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3422:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3696:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3698:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3877:Ckap5 UTSW 2 91615150 missense possibly damaging 0.69
R4453:Ckap5 UTSW 2 91548845 missense probably damaging 1.00
R4604:Ckap5 UTSW 2 91578131 missense probably benign 0.00
R4605:Ckap5 UTSW 2 91576214 missense probably damaging 1.00
R4849:Ckap5 UTSW 2 91615271 missense probably damaging 1.00
R5267:Ckap5 UTSW 2 91591752 missense probably null 1.00
R5367:Ckap5 UTSW 2 91615141 missense possibly damaging 0.69
R5481:Ckap5 UTSW 2 91572447 missense possibly damaging 0.62
R5546:Ckap5 UTSW 2 91594816 missense probably damaging 1.00
R5704:Ckap5 UTSW 2 91576203 missense probably damaging 1.00
R5786:Ckap5 UTSW 2 91616296 splice site probably null
R5793:Ckap5 UTSW 2 91619835 missense possibly damaging 0.74
R5824:Ckap5 UTSW 2 91559136 missense probably benign 0.34
R5841:Ckap5 UTSW 2 91600682 missense probably benign 0.05
R5875:Ckap5 UTSW 2 91560861 missense probably benign
R5935:Ckap5 UTSW 2 91615100 missense possibly damaging 0.68
R6008:Ckap5 UTSW 2 91562989 missense probably damaging 0.99
R6174:Ckap5 UTSW 2 91568219 missense probably benign 0.00
R6343:Ckap5 UTSW 2 91596474 missense possibly damaging 0.95
R6624:Ckap5 UTSW 2 91577651 missense probably benign 0.01
R6786:Ckap5 UTSW 2 91557575 missense probably benign 0.01
R6793:Ckap5 UTSW 2 91568709 missense probably damaging 1.00
R6841:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R6972:Ckap5 UTSW 2 91606313 missense probably damaging 0.98
R7044:Ckap5 UTSW 2 91577601 missense probably benign
R7790:Ckap5 UTSW 2 91559110 missense probably benign
R7809:Ckap5 UTSW 2 91606357 missense probably benign 0.28
X0010:Ckap5 UTSW 2 91596509 missense possibly damaging 0.61
Z1177:Ckap5 UTSW 2 91585798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCACAGAGTAAATCTTTGTC -3'
(R):5'- CTGAATGGTAGGCAAGCACTC -3'

Sequencing Primer
(F):5'- CCAACTATGTTTTTCTTCTTTGTCTC -3'
(R):5'- GTAGGCAAGCACTCTACTGACTG -3'
Posted On2019-05-15