Incidental Mutation 'R7111:Vmn2r31'
ID551510
Institutional Source Beutler Lab
Gene Symbol Vmn2r31
Ensembl Gene ENSMUSG00000096373
Gene Namevomeronasal 2, receptor 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7111 (G1)
Quality Score161.009
Status Not validated
Chromosome7
Chromosomal Location7383027-7399743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7396481 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 159 (F159S)
Ref Sequence ENSEMBL: ENSMUSP00000074613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075108]
Predicted Effect probably damaging
Transcript: ENSMUST00000075108
AA Change: F159S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074613
Gene: ENSMUSG00000096373
AA Change: F159S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 8.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Vmn2r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Vmn2r31 APN 7 7396566 missense probably damaging 0.98
IGL01536:Vmn2r31 APN 7 7384848 missense probably damaging 1.00
IGL01985:Vmn2r31 APN 7 7394511 missense probably benign
IGL02116:Vmn2r31 APN 7 7394549 missense probably damaging 0.97
FR4304:Vmn2r31 UTSW 7 7384608 missense probably damaging 1.00
R1609:Vmn2r31 UTSW 7 7384889 missense probably damaging 1.00
R4647:Vmn2r31 UTSW 7 7384368 missense probably damaging 1.00
R4724:Vmn2r31 UTSW 7 7384758 missense possibly damaging 0.63
R4824:Vmn2r31 UTSW 7 7387063 critical splice donor site probably null
R5619:Vmn2r31 UTSW 7 7384530 nonsense probably null
R6225:Vmn2r31 UTSW 7 7394639 missense probably benign 0.19
R6610:Vmn2r31 UTSW 7 7384589 missense probably damaging 0.97
R6956:Vmn2r31 UTSW 7 7394506 missense probably benign
R7219:Vmn2r31 UTSW 7 7387106 missense probably benign
R7219:Vmn2r31 UTSW 7 7394398 missense probably damaging 0.97
R7300:Vmn2r31 UTSW 7 7384776 missense possibly damaging 0.61
R7395:Vmn2r31 UTSW 7 7384745 missense probably damaging 1.00
R7481:Vmn2r31 UTSW 7 7384580 missense possibly damaging 0.94
R8015:Vmn2r31 UTSW 7 7384200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGACTTAATTCTACATGG -3'
(R):5'- GGCCGTTGTGATGGGAAAAC -3'

Sequencing Primer
(F):5'- CCATGAAGGTATCTGTCAACTTCTGG -3'
(R):5'- CCGTTGTGATGGGAAAACTGTAATAC -3'
Posted On2019-05-15