Incidental Mutation 'R7111:Umod'
ID551512
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Nameuromodulin
Synonymsuromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119462711-119479282 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 119477146 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 132 (Y132*)
Ref Sequence ENSEMBL: ENSMUSP00000033263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000207261] [ENSMUST00000207460] [ENSMUST00000209095]
Predicted Effect probably null
Transcript: ENSMUST00000033263
AA Change: Y132*
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: Y132*

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207261
Predicted Effect probably benign
Transcript: ENSMUST00000207378
Predicted Effect probably null
Transcript: ENSMUST00000207460
AA Change: Y132*
Predicted Effect probably null
Transcript: ENSMUST00000209095
AA Change: Y132*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119477219 missense possibly damaging 0.93
IGL02527:Umod APN 7 119469467 missense probably damaging 1.00
R0265:Umod UTSW 7 119466073 missense probably benign 0.00
R1073:Umod UTSW 7 119464741 missense possibly damaging 0.56
R1117:Umod UTSW 7 119477306 missense possibly damaging 0.71
R1515:Umod UTSW 7 119465497 missense probably benign 0.00
R1774:Umod UTSW 7 119477351 missense possibly damaging 0.82
R1803:Umod UTSW 7 119464724 missense probably damaging 0.96
R1864:Umod UTSW 7 119463255 missense probably damaging 0.99
R1942:Umod UTSW 7 119476932 missense probably damaging 1.00
R2060:Umod UTSW 7 119476715 missense probably damaging 0.97
R2354:Umod UTSW 7 119466193 missense probably damaging 1.00
R3015:Umod UTSW 7 119472540 missense probably damaging 1.00
R3030:Umod UTSW 7 119476839 missense probably benign 0.02
R4016:Umod UTSW 7 119476690 missense possibly damaging 0.56
R4406:Umod UTSW 7 119466064 missense probably damaging 1.00
R4446:Umod UTSW 7 119466056 splice site probably null
R5062:Umod UTSW 7 119472421 nonsense probably null
R5358:Umod UTSW 7 119472354 missense probably damaging 1.00
R5935:Umod UTSW 7 119471427 missense probably damaging 1.00
R6045:Umod UTSW 7 119476823 missense probably benign
R6239:Umod UTSW 7 119477297 missense probably damaging 1.00
R7168:Umod UTSW 7 119478326 splice site probably benign
R7265:Umod UTSW 7 119466073 missense probably benign 0.00
R7273:Umod UTSW 7 119477027 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACACCATACTCTGTGCTGC -3'
(R):5'- ACGGTGTTCTGAATGCCAC -3'

Sequencing Primer
(F):5'- ATACTCTGTGCTGCGCCAG -3'
(R):5'- ACATGGATGAGTGTGCTACCC -3'
Posted On2019-05-15