Incidental Mutation 'R7111:Zfp866'
ID551517
Institutional Source Beutler Lab
Gene Symbol Zfp866
Ensembl Gene ENSMUSG00000043090
Gene Namezinc finger protein 866
Synonyms9830167H18Rik, D330038O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69761326-69791178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69766571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 133 (V133D)
Ref Sequence ENSEMBL: ENSMUSP00000119781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131784] [ENSMUST00000137573] [ENSMUST00000149782]
Predicted Effect probably benign
Transcript: ENSMUST00000126915
SMART Domains Protein: ENSMUSP00000122850
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 16 73 1.96e-17 SMART
PDB:2I13|B 104 210 3e-6 PDB
SCOP:d1fgja_ 114 216 2e-6 SMART
Blast:KRAB 189 209 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131784
SMART Domains Protein: ENSMUSP00000116972
Gene: ENSMUSG00000043090

DomainStartEndE-ValueType
Blast:KRAB 1 35 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137573
AA Change: V133D

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119781
Gene: ENSMUSG00000043090
AA Change: V133D

DomainStartEndE-ValueType
KRAB 4 67 4.26e-18 SMART
ZnF_C2H2 162 184 6.42e-4 SMART
ZnF_C2H2 190 212 3.69e-4 SMART
ZnF_C2H2 218 240 3.89e-3 SMART
ZnF_C2H2 246 268 3.34e-2 SMART
ZnF_C2H2 274 296 1.76e-1 SMART
ZnF_C2H2 302 324 5.42e-2 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 6.78e-3 SMART
ZnF_C2H2 386 408 2.09e-3 SMART
ZnF_C2H2 414 436 9.44e-2 SMART
ZnF_C2H2 442 464 2.95e-3 SMART
ZnF_C2H2 470 492 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149782
SMART Domains Protein: ENSMUSP00000123252
Gene: ENSMUSG00000092544

DomainStartEndE-ValueType
KRAB 80 139 1.2e-17 SMART
ZnF_C2H2 155 177 1.69e-3 SMART
ZnF_C2H2 182 204 8.47e-4 SMART
ZnF_C2H2 210 232 7.15e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Other mutations in Zfp866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Zfp866 APN 8 69766640 critical splice donor site probably null
R0238:Zfp866 UTSW 8 69766715 missense probably damaging 1.00
R1073:Zfp866 UTSW 8 69767622 splice site probably benign
R1226:Zfp866 UTSW 8 69766290 missense probably damaging 1.00
R1388:Zfp866 UTSW 8 69766184 missense probably benign 0.16
R5129:Zfp866 UTSW 8 69767709 intron probably null
R5204:Zfp866 UTSW 8 69766040 missense probably damaging 0.96
R5225:Zfp866 UTSW 8 69765441 missense possibly damaging 0.93
R5504:Zfp866 UTSW 8 69765691 missense probably benign 0.07
R5912:Zfp866 UTSW 8 69766284 missense probably benign 0.03
R6046:Zfp866 UTSW 8 69765723 missense probably damaging 1.00
R6939:Zfp866 UTSW 8 69766221 missense probably damaging 0.99
R7033:Zfp866 UTSW 8 69765841 missense probably damaging 1.00
R7351:Zfp866 UTSW 8 69765897 missense probably damaging 1.00
R7458:Zfp866 UTSW 8 69765552 nonsense probably null
R8098:Zfp866 UTSW 8 69765978 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTGACATTTATAGGGTCTCTC -3'
(R):5'- TGCCGAACCTCAATAGAAGC -3'

Sequencing Primer
(F):5'- GACATTTATAGGGTCTCTCTCCTGTG -3'
(R):5'- TCTGAATACTTACTGGATGAGCAGG -3'
Posted On2019-05-15