Incidental Mutation 'R7111:Cd79b'
ID551528
Institutional Source Beutler Lab
Gene Symbol Cd79b
Ensembl Gene ENSMUSG00000040592
Gene NameCD79B antigen
SynonymsIgbeta, Ig-beta, Igb, B29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106311341-106314762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106314539 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 42 (I42M)
Ref Sequence ENSEMBL: ENSMUSP00000048239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056] [ENSMUST00000044228] [ENSMUST00000167143]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000044228
AA Change: I42M

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592
AA Change: I42M

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167143
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Cd79b
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106312441 critical splice acceptor site probably null
Jeju UTSW 11 106312713 missense probably damaging 1.00
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0731:Cd79b UTSW 11 106312433 missense probably damaging 1.00
R4400:Cd79b UTSW 11 106312010 nonsense probably null
R4591:Cd79b UTSW 11 106312046 missense probably damaging 1.00
R4948:Cd79b UTSW 11 106312861 missense probably benign 0.01
R6214:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106312713 missense probably damaging 1.00
R7114:Cd79b UTSW 11 106311887 missense probably damaging 1.00
R7401:Cd79b UTSW 11 106312852 missense probably benign 0.02
R8052:Cd79b UTSW 11 106313700 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGACGGTCCTGTCTCAAAG -3'
(R):5'- TCCCTAGAAGATTCAGGAGCAAC -3'

Sequencing Primer
(F):5'- TGTCTCAAAGCCAGCGAG -3'
(R):5'- GTCTCTCAAGAACCCAAAGCTGTG -3'
Posted On2019-05-15