Incidental Mutation 'R7111:Nme8'
ID551530
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene NameNME/NM23 family member 8
SynonymsSptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location19645078-19697794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19675647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 268 (R268W)
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763] [ENSMUST00000223466]
Predicted Effect probably benign
Transcript: ENSMUST00000039340
AA Change: R268W

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: R268W

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091763
AA Change: R268W

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: R268W

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223466
AA Change: R29W

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
R8108:Nme8 UTSW 13 19650960 missense probably benign 0.00
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTGGGTGCCAGGCTTAGAAAAG -3'
(R):5'- CCTGACTTTGAAGAGTTTGTCG -3'

Sequencing Primer
(F):5'- AGCAAGGAAGTTATGCCGTTTC -3'
(R):5'- GTCGTTTCTATGACAAATGGCCTCAG -3'
Posted On2019-05-15