Incidental Mutation 'R7111:Grk6'
ID551531
Institutional Source Beutler Lab
Gene Symbol Grk6
Ensembl Gene ENSMUSG00000074886
Gene NameG protein-coupled receptor kinase 6
SynonymsGprk6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55445072-55460927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55458920 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 511 (W511L)
Ref Sequence ENSEMBL: ENSMUSP00000001115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]
Predicted Effect probably damaging
Transcript: ENSMUST00000001115
AA Change: W511L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886
AA Change: W511L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
low complexity region 572 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099482
AA Change: W511L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886
AA Change: W511L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224118
AA Change: W511L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224653
AA Change: W479L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224995
AA Change: W506L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225925
AA Change: W477L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.9104 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Grk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Grk6 APN 13 55451391 missense possibly damaging 0.92
IGL02054:Grk6 APN 13 55454397 missense probably benign 0.03
IGL02156:Grk6 APN 13 55449361 missense possibly damaging 0.86
IGL02442:Grk6 APN 13 55458937 splice site probably benign
IGL02750:Grk6 APN 13 55451543 missense probably damaging 1.00
IGL03340:Grk6 APN 13 55453190 missense probably damaging 1.00
Damper UTSW 13 55458920 missense probably damaging 1.00
Piano UTSW 13 55454527 critical splice donor site probably null
R0080:Grk6 UTSW 13 55458910 missense probably benign 0.00
R1077:Grk6 UTSW 13 55454527 critical splice donor site probably null
R1530:Grk6 UTSW 13 55458799 missense probably damaging 0.99
R1531:Grk6 UTSW 13 55452154 missense probably damaging 1.00
R1733:Grk6 UTSW 13 55453166 splice site probably benign
R1851:Grk6 UTSW 13 55451778 nonsense probably null
R1874:Grk6 UTSW 13 55450273 missense probably damaging 1.00
R2142:Grk6 UTSW 13 55454364 missense probably damaging 1.00
R2875:Grk6 UTSW 13 55452304 missense probably damaging 1.00
R5187:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R7010:Grk6 UTSW 13 55450300 missense possibly damaging 0.74
R7104:Grk6 UTSW 13 55454406 missense probably benign 0.36
R7769:Grk6 UTSW 13 55451007 missense probably benign 0.01
R7982:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R8401:Grk6 UTSW 13 55452168 missense possibly damaging 0.95
R8468:Grk6 UTSW 13 55451385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGGATGCTGCCAAGGG -3'
(R):5'- GAGTCTCTGTAGCAATCCCTTC -3'

Sequencing Primer
(F):5'- GTGGCAGACTCAAGCCCTC -3'
(R):5'- GGGGGTGCAGTGGGCTG -3'
Posted On2019-05-15