Incidental Mutation 'R7111:Krt86'
ID551533
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Namekeratin 86
SynonymsKrt2-10, Khb4, Krt2-11, MHb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101473478-101479986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101476617 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 297 (Y297F)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088049
AA Change: Y297F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: Y297F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1163 G A 2: 88,070,656 T242I probably damaging Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4464:Krt86 UTSW 15 101473914 missense probably damaging 0.99
R4985:Krt86 UTSW 15 101477265 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5600:Krt86 UTSW 15 101476505 missense probably benign 0.00
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R5876:Krt86 UTSW 15 101476610 missense probably damaging 0.98
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
Z1177:Krt86 UTSW 15 101476897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGTCTTGTGTGGACCAGG -3'
(R):5'- ACAATGGATGTGCAAGATGC -3'

Sequencing Primer
(F):5'- GGCTGAGCCTTCAAGAAGTTTTTATC -3'
(R):5'- ATGCACAGTGGTCAGGCTG -3'
Posted On2019-05-15