Incidental Mutation 'R7112:Slco4c1'
ID551541
Institutional Source Beutler Lab
Gene Symbol Slco4c1
Ensembl Gene ENSMUSG00000040693
Gene Namesolute carrier organic anion transporter family, member 4C1
SynonymsOATP-H, OATP4C1, PRO2176, OATP-M1, SLC21A20, C330017E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7112 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location96816270-96872171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 96841141 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 332 (K332T)
Ref Sequence ENSEMBL: ENSMUSP00000071875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071985]
Predicted Effect probably damaging
Transcript: ENSMUST00000071985
AA Change: K332T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071875
Gene: ENSMUSG00000040693
AA Change: K332T

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
Pfam:MFS_1 102 483 1.3e-19 PFAM
KAZAL 503 547 1.67e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Cdh8 T C 8: 99,196,352 D304G probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Loxhd1 T A 18: 77,388,514 V1159E probably damaging Het
Malrd1 A G 2: 15,925,176 N1498D unknown Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Stim1 A G 7: 102,408,408 T143A probably benign Het
Tbr1 A G 2: 61,811,816 D475G probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Slco4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Slco4c1 APN 1 96841187 missense probably damaging 0.99
IGL01510:Slco4c1 APN 1 96867953 missense probably damaging 1.00
IGL01674:Slco4c1 APN 1 96842493 missense probably damaging 1.00
IGL02444:Slco4c1 APN 1 96844509 missense probably damaging 1.00
IGL03355:Slco4c1 APN 1 96842507 nonsense probably null
H8562:Slco4c1 UTSW 1 96842485 missense probably benign 0.01
H8786:Slco4c1 UTSW 1 96841151 missense probably damaging 1.00
R0350:Slco4c1 UTSW 1 96828849 missense probably benign 0.18
R0463:Slco4c1 UTSW 1 96867920 missense possibly damaging 0.93
R0550:Slco4c1 UTSW 1 96867859 missense probably damaging 1.00
R1122:Slco4c1 UTSW 1 96828836 missense possibly damaging 0.89
R1205:Slco4c1 UTSW 1 96867888 missense probably damaging 1.00
R1215:Slco4c1 UTSW 1 96828871 missense probably damaging 1.00
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1907:Slco4c1 UTSW 1 96842499 missense probably damaging 1.00
R1960:Slco4c1 UTSW 1 96867929 missense probably benign 0.00
R2372:Slco4c1 UTSW 1 96821200 missense probably benign 0.00
R3424:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R3425:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R4292:Slco4c1 UTSW 1 96844656 critical splice acceptor site probably null
R4656:Slco4c1 UTSW 1 96841245 missense probably benign 0.01
R4852:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4854:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4865:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4867:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4898:Slco4c1 UTSW 1 96837512 missense probably damaging 1.00
R4900:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5023:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5074:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5348:Slco4c1 UTSW 1 96842529 missense probably damaging 0.99
R5356:Slco4c1 UTSW 1 96832110 missense probably damaging 1.00
R5471:Slco4c1 UTSW 1 96872045 missense probably benign 0.34
R5683:Slco4c1 UTSW 1 96867834 missense probably damaging 1.00
R5797:Slco4c1 UTSW 1 96819104 missense probably benign 0.04
R5801:Slco4c1 UTSW 1 96872084 missense probably damaging 0.96
R5837:Slco4c1 UTSW 1 96818982 missense probably benign 0.40
R6242:Slco4c1 UTSW 1 96839283 missense probably damaging 0.99
R7014:Slco4c1 UTSW 1 96823781 splice site probably null
R7174:Slco4c1 UTSW 1 96837598 missense possibly damaging 0.87
R7265:Slco4c1 UTSW 1 96871793 missense probably damaging 0.99
R7275:Slco4c1 UTSW 1 96871772 missense probably benign 0.38
R7305:Slco4c1 UTSW 1 96828965 missense probably damaging 1.00
R7428:Slco4c1 UTSW 1 96837520 missense possibly damaging 0.68
R7649:Slco4c1 UTSW 1 96828942 missense probably benign 0.03
R7980:Slco4c1 UTSW 1 96836925 missense probably benign 0.20
R8137:Slco4c1 UTSW 1 96821245 missense probably damaging 1.00
R8188:Slco4c1 UTSW 1 96844536 missense probably damaging 1.00
R8488:Slco4c1 UTSW 1 96832011 missense probably benign 0.02
Z1176:Slco4c1 UTSW 1 96821230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTACTCACTAAGTATAAGTGC -3'
(R):5'- TTTAGATAAAGTCAGAGCCTACCC -3'

Sequencing Primer
(F):5'- CTATGACAGGAATTGGGTG -3'
(R):5'- GATAAAGTCAGAGCCTACCCCTTTG -3'
Posted On2019-05-15