Incidental Mutation 'R7112:Malrd1'
ID551542
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene NameMAM and LDL receptor class A domain containing 1
SynonymsDiet1, Gm13364, Gm13318
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7112 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location15526479-16255555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15925176 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1498 (N1498D)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
Predicted Effect unknown
Transcript: ENSMUST00000146205
AA Change: N1498D
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: N1498D

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Cdh8 T C 8: 99,196,352 D304G probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Loxhd1 T A 18: 77,388,514 V1159E probably damaging Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Slco4c1 T G 1: 96,841,141 K332T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Stim1 A G 7: 102,408,408 T143A probably benign Het
Tbr1 A G 2: 61,811,816 D475G probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16142186 splice site probably benign
IGL01295:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01296:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01399:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01400:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01401:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01402:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01405:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01406:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL02105:Malrd1 APN 2 16127863 missense unknown
IGL02581:Malrd1 APN 2 16142312 nonsense probably null
IGL03015:Malrd1 APN 2 16042271 missense unknown
IGL03038:Malrd1 APN 2 16127967 missense unknown
R1353:Malrd1 UTSW 2 16127968 missense unknown
R1385:Malrd1 UTSW 2 16042228 missense unknown
R2242:Malrd1 UTSW 2 16101944 missense unknown
R2888:Malrd1 UTSW 2 16074757 missense unknown
R4398:Malrd1 UTSW 2 16150783 missense unknown
R4982:Malrd1 UTSW 2 16042129 missense probably benign 0.29
R5148:Malrd1 UTSW 2 16142226 missense unknown
R5195:Malrd1 UTSW 2 16150810 missense unknown
R5828:Malrd1 UTSW 2 15526653 missense probably benign 0.00
R5892:Malrd1 UTSW 2 15614267 missense probably benign 0.03
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15695326 missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16042267 missense unknown
R6438:Malrd1 UTSW 2 15614206 missense
R6457:Malrd1 UTSW 2 15526597 start gained probably benign
R6457:Malrd1 UTSW 2 15667929 missense probably benign 0.41
R6499:Malrd1 UTSW 2 15931689 missense probably benign 0.03
R6575:Malrd1 UTSW 2 15842628 missense probably benign 0.00
R6792:Malrd1 UTSW 2 16150756 missense unknown
R6796:Malrd1 UTSW 2 15869784 missense unknown
R6930:Malrd1 UTSW 2 15797667 missense unknown
R6959:Malrd1 UTSW 2 16218009 missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16150791 missense unknown
R7102:Malrd1 UTSW 2 16142303 missense unknown
R7248:Malrd1 UTSW 2 16101911 missense unknown
R7249:Malrd1 UTSW 2 15623340 missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16006718 missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15695199 missense unknown
R7399:Malrd1 UTSW 2 15610090 missense
R7476:Malrd1 UTSW 2 16142304 missense unknown
R7582:Malrd1 UTSW 2 15695270 missense unknown
R7604:Malrd1 UTSW 2 15925192 missense unknown
R7662:Malrd1 UTSW 2 15871454 missense unknown
R7681:Malrd1 UTSW 2 16218102 missense unknown
R7740:Malrd1 UTSW 2 15614215 missense not run
R7747:Malrd1 UTSW 2 16074835 missense unknown
R7754:Malrd1 UTSW 2 15797799 splice site probably null
R7950:Malrd1 UTSW 2 16128068 missense unknown
R8194:Malrd1 UTSW 2 15925120 missense unknown
R8260:Malrd1 UTSW 2 15614206 missense
R8314:Malrd1 UTSW 2 15752832 missense unknown
R8342:Malrd1 UTSW 2 15633224 missense unknown
R8386:Malrd1 UTSW 2 15696844 missense unknown
R8492:Malrd1 UTSW 2 15610123 missense
R8728:Malrd1 UTSW 2 15696942 nonsense probably null
R8756:Malrd1 UTSW 2 15752895 critical splice donor site probably null
Z1176:Malrd1 UTSW 2 16217845 missense unknown
Z1191:Malrd1 UTSW 2 16042226 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAATAACCATGCATTCCATTTGTG -3'
(R):5'- CTGTGGGTGGCTACAAACAAC -3'

Sequencing Primer
(F):5'- GCATTCCATTTGTGTTTCATTCCAGG -3'
(R):5'- GGGTGGCTACAAACAACAGCATC -3'
Posted On2019-05-15