Incidental Mutation 'R0598:Mrps9'
ID 55156
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms
MMRRC Submission 038787-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R0598 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 42851233-42905683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42905417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 365 (T365I)
Ref Sequence ENSEMBL: ENSMUSP00000056855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably damaging
Transcript: ENSMUST00000057208
AA Change: T365I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: T365I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185523
Predicted Effect probably benign
Transcript: ENSMUST00000201108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202358
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,404 S196L probably benign Het
3110035E14Rik T G 1: 9,619,842 I98S probably benign Het
4933427I04Rik A T 4: 123,860,888 E198D possibly damaging Het
Abca6 A T 11: 110,197,154 I1049N probably damaging Het
Acly A T 11: 100,478,390 N1014K probably damaging Het
Aph1c A T 9: 66,833,319 W42R probably damaging Het
Bptf G T 11: 107,072,965 T1738K probably damaging Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Cpt2 G T 4: 107,906,938 T543N probably damaging Het
Dnah9 T C 11: 66,118,877 E728G probably benign Het
Doxl2 A G 6: 48,975,537 E132G probably benign Het
Gm5689 T A 18: 42,173,371 M1K probably null Het
Itgbl1 A G 14: 123,857,436 H167R possibly damaging Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
L3mbtl4 T G 17: 68,459,773 D158E probably benign Het
Lrp8 A C 4: 107,857,237 I603L possibly damaging Het
Olfr1389 A G 11: 49,431,403 D309G probably benign Het
Olfr20 G T 11: 73,353,903 R50L probably benign Het
Olfr403 A T 11: 74,195,832 T110S possibly damaging Het
Padi1 C A 4: 140,814,787 R608L possibly damaging Het
Pkhd1 A T 1: 20,200,890 F3146L probably damaging Het
Rnf145 T C 11: 44,548,943 S189P probably damaging Het
Sez6 G T 11: 77,977,821 D974Y possibly damaging Het
St3gal3 A T 4: 118,107,632 L11Q probably benign Het
Syt14 T C 1: 192,897,314 E554G probably damaging Het
Tectb G T 19: 55,189,586 E170* probably null Het
Themis2 A T 4: 132,789,683 C169S possibly damaging Het
Tmem88b A T 4: 155,784,367 D141E probably benign Het
Uaca T A 9: 60,870,921 Y685* probably null Het
Vsnl1 T C 12: 11,386,859 S40G probably benign Het
Wdr64 A T 1: 175,805,899 Q905H probably damaging Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42905459 missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42903397 missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42851350 missense probably benign
IGL02541:Mrps9 APN 1 42862654 splice site probably null
PIT4402001:Mrps9 UTSW 1 42896098 missense probably benign 0.10
R1718:Mrps9 UTSW 1 42903399 missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42901094 intron probably benign
R4196:Mrps9 UTSW 1 42901094 intron probably benign
R4695:Mrps9 UTSW 1 42862515 missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42898415 intron probably benign
R5033:Mrps9 UTSW 1 42895331 splice site probably null
R5489:Mrps9 UTSW 1 42898433 splice site probably benign
R5876:Mrps9 UTSW 1 42895378 missense probably damaging 0.99
R6891:Mrps9 UTSW 1 42905413 missense probably damaging 1.00
R7015:Mrps9 UTSW 1 42898546 missense probably benign 0.04
R7940:Mrps9 UTSW 1 42862648 missense probably damaging 0.98
R8679:Mrps9 UTSW 1 42879755 missense probably damaging 0.99
R9117:Mrps9 UTSW 1 42903377 missense probably benign 0.22
Z1177:Mrps9 UTSW 1 42899458 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGAAATGACCTCATCGGAACAGGC -3'
(R):5'- TGTGGGACAACCACCTAGCATCAG -3'

Sequencing Primer
(F):5'- ATCGGAACAGGCTGCCTC -3'
(R):5'- GGCCGCTTCACCTTTTAAATAAG -3'
Posted On 2013-07-11