Incidental Mutation 'R7112:Stim1'
ID551564
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Namestromal interaction molecule 1
SynonymsSIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7112 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102267806-102437319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102408408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 143 (T143A)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
Predicted Effect probably benign
Transcript: ENSMUST00000033289
AA Change: T143A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: T143A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
AA Change: T143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: T143A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Cdh8 T C 8: 99,196,352 D304G probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Loxhd1 T A 18: 77,388,514 V1159E probably damaging Het
Malrd1 A G 2: 15,925,176 N1498D unknown Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Slco4c1 T G 1: 96,841,141 K332T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Tbr1 A G 2: 61,811,816 D475G probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACAAACATGACAAGTGCGTGTTC -3'
(R):5'- GACTCTGCTGAGGATGAAGC -3'

Sequencing Primer
(F):5'- ACAAGTGCGTGTTCAGCATG -3'
(R):5'- GCTTTACTGAATTGTCCAGAGCAACC -3'
Posted On2019-05-15