Mutagenetix > Incidental Mutation

Incidental Mutation 'R7112:Scn11a'

551575

Institutional Source

Beutler Lab

Gene Symbol

Scn11a

Ensembl Gene

ENSMUSG00000034115

Gene Name

sodium channel, voltage-gated, type XI, alpha

Synonyms

NaN, NSS2, NaT, SNS2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R7112 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119753759-119825456 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119754809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1580 (I1580T)

Ref Sequence

ENSEMBL: ENSMUSP00000065466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]

AlphaFold

Q9R053

Predicted Effect

probably damaging
Transcript: ENSMUST00000070617
AA Change: I1580T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1580T

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:Ion_trans	128	409	1.1e-72	PFAM
low complexity region	475	487	N/A	INTRINSIC
Pfam:Ion_trans	574	810	4e-57	PFAM
Pfam:Na_trans_assoc	814	1030	4.1e-29	PFAM
Pfam:Ion_trans	1034	1300	5.7e-66	PFAM
Pfam:Ion_trans	1346	1595	3e-58	PFAM
low complexity region	1683	1694	N/A	INTRINSIC
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215718
AA Change: I1580T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	G	T	12: 112,783,119	A1036E		Het
Baz2b	A	T	2: 59,962,184	H533Q	possibly damaging	Het
Bcl2l11	T	A	2: 128,158,315	W193R	probably damaging	Het
Bcl2l12	C	T	7: 44,996,914	G24D	probably damaging	Het
Cacna1b	A	G	2: 24,690,761	V691A	probably damaging	Het
Cdh8	T	C	8: 99,196,352	D304G	probably damaging	Het
Ces3a	A	T	8: 105,057,962	Q525H	probably damaging	Het
Csmd1	C	A	8: 16,101,128	C1391F	probably damaging	Het
Cul7	G	T	17: 46,651,698	G85V	probably damaging	Het
Dnah8	G	A	17: 30,871,392	V4623I	possibly damaging	Het
Dnhd1	T	A	7: 105,713,985	L3918Q	probably damaging	Het
Exoc4	A	T	6: 33,921,488	N881Y	probably damaging	Het
Flt1	G	C	5: 147,603,569	A770G	probably damaging	Het
Fndc5	A	G	4: 129,142,122	N184S	probably benign	Het
Folh1	A	G	7: 86,775,637		probably null	Het
Frem3	A	T	8: 80,612,031	T318S	probably damaging	Het
Gba2	A	G	4: 43,568,453	V671A	probably benign	Het
Gm7102	T	G	19: 61,175,559	D146A	probably damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Jph2	G	A	2: 163,375,784	T324M	probably damaging	Het
Kank4	A	G	4: 98,761,521	V937A	probably damaging	Het
Kdm3a	T	A	6: 71,632,170	E24D	probably benign	Het
Kidins220	T	A	12: 25,004,019	L464Q	probably damaging	Het
Loxhd1	T	A	18: 77,388,514	V1159E	probably damaging	Het
Malrd1	A	G	2: 15,925,176	N1498D	unknown	Het
Mrgprb5	C	T	7: 48,168,907	V27I	probably benign	Het
Mtfr2	A	G	10: 20,357,566	N294D	probably damaging	Het
Muc6	A	T	7: 141,649,277	L498H	probably damaging	Het
N4bp2	A	G	5: 65,790,707	T227A	possibly damaging	Het
Nin	C	T	12: 70,102,799	R12Q		Het
Obscn	G	C	11: 59,029,325	A27G		Het
Olfr284	T	A	15: 98,340,540	M150L	possibly damaging	Het
Olfr582	G	A	7: 103,041,655	D54N	probably damaging	Het
Olfr729	T	G	14: 50,147,935	E313A	probably benign	Het
Olfr746	T	A	14: 50,654,126	D296E	probably benign	Het
Olfr912	T	A	9: 38,582,034	Y252*	probably null	Het
Polr2a	A	G	11: 69,735,309	S1672P	unknown	Het
Qprt	A	G	7: 127,108,189	V245A	probably damaging	Het
Rab11fip5	T	A	6: 85,348,194	E377V	probably damaging	Het
Rere	A	G	4: 150,406,604	T71A	probably benign	Het
Ret	A	T	6: 118,197,102	L11Q	possibly damaging	Het
Rp1	C	T	1: 4,349,018	V624I	probably benign	Het
Scaf8	T	A	17: 3,163,029	L131H	unknown	Het
Scgb2a2	A	G	19: 9,851,657	R58G	probably benign	Het
Slco4c1	T	G	1: 96,841,141	K332T	probably damaging	Het
Sntg1	T	G	1: 8,448,065	Y368S	possibly damaging	Het
Stim1	A	G	7: 102,408,408	T143A	probably benign	Het
Tbr1	A	G	2: 61,811,816	D475G	probably benign	Het
Tcp1	A	G	17: 12,917,873	D47G	probably damaging	Het
Tpgs2	T	C	18: 25,149,137	D119G	probably damaging	Het
Trim40	C	A	17: 36,882,642	R225M	probably null	Het
Tro	GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	X: 150,645,856		probably benign	Het
Trpm1	A	T	7: 64,235,845	N870Y	probably damaging	Het
Tsr3	A	G	17: 25,240,471	D47G	probably benign	Het
Vil1	G	A	1: 74,416,002	G38R	probably damaging	Het
Vmn2r91	A	T	17: 18,105,618	Q166L	possibly damaging	Het
Wdr33	C	T	18: 31,893,003	T919I	unknown	Het
Wdr36	T	C	18: 32,839,451	V64A	probably benign	Het
Xpnpep1	T	C	19: 53,010,107	I237V	probably benign	Het
Zfp780b	A	T	7: 27,963,141	I663N	probably damaging	Het
Zfyve9	G	A	4: 108,650,322	A513V	probably benign	Het

Other mutations in Scn11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Scn11a	APN	9	119770506	missense	probably benign	0.00
IGL00272:Scn11a	APN	9	119816603	missense	probably damaging	0.98
IGL00332:Scn11a	APN	9	119769916	missense	probably damaging	1.00
IGL00533:Scn11a	APN	9	119774381	missense	probably damaging	1.00
IGL00972:Scn11a	APN	9	119793938	missense	probably benign	0.44
IGL01338:Scn11a	APN	9	119784161	splice site	probably benign
IGL01534:Scn11a	APN	9	119780822	missense	probably benign	0.27
IGL01838:Scn11a	APN	9	119758583	missense	probably damaging	1.00
IGL01991:Scn11a	APN	9	119819904	missense	probably damaging	0.97
IGL02057:Scn11a	APN	9	119765470	missense	probably damaging	1.00
IGL02290:Scn11a	APN	9	119774442	missense	probably damaging	0.97
IGL02454:Scn11a	APN	9	119758544	missense	probably benign	0.00
IGL02517:Scn11a	APN	9	119792398	missense	probably damaging	1.00
IGL02567:Scn11a	APN	9	119804489	missense	probably damaging	0.99
IGL02587:Scn11a	APN	9	119805684	missense	probably damaging	1.00
IGL03069:Scn11a	APN	9	119789963	missense	probably benign	0.16
IGL03171:Scn11a	APN	9	119819847	missense	probably benign	0.00
Kleinie	UTSW	9	119803503	missense	probably benign	0.16
H8441:Scn11a	UTSW	9	119807910	missense	probably damaging	1.00
PIT4449001:Scn11a	UTSW	9	119769948	missense	probably damaging	1.00
R0304:Scn11a	UTSW	9	119819862	missense	probably benign	0.00
R0519:Scn11a	UTSW	9	119790119	missense	probably damaging	1.00
R0658:Scn11a	UTSW	9	119811160	missense	probably benign	0.41
R0828:Scn11a	UTSW	9	119755007	missense	probably benign	0.00
R0893:Scn11a	UTSW	9	119803330	splice site	probably null
R0932:Scn11a	UTSW	9	119807810	missense	probably damaging	1.00
R1061:Scn11a	UTSW	9	119795663	missense	probably damaging	0.98
R1161:Scn11a	UTSW	9	119755057	nonsense	probably null
R1162:Scn11a	UTSW	9	119805644	splice site	probably benign
R1310:Scn11a	UTSW	9	119755057	nonsense	probably null
R1589:Scn11a	UTSW	9	119769807	missense	probably damaging	1.00
R1681:Scn11a	UTSW	9	119804412	missense	possibly damaging	0.46
R1781:Scn11a	UTSW	9	119755082	missense	probably damaging	1.00
R1812:Scn11a	UTSW	9	119780865	nonsense	probably null
R1901:Scn11a	UTSW	9	119779036	nonsense	probably null
R1978:Scn11a	UTSW	9	119780795	nonsense	probably null
R1985:Scn11a	UTSW	9	119754678	missense	probably benign	0.19
R2022:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2072:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2098:Scn11a	UTSW	9	119792494	missense	possibly damaging	0.67
R2163:Scn11a	UTSW	9	119755025	missense	probably damaging	1.00
R2250:Scn11a	UTSW	9	119758602	missense	probably benign	0.01
R2373:Scn11a	UTSW	9	119813186	missense	probably benign	0.43
R2508:Scn11a	UTSW	9	119765529	missense	probably damaging	1.00
R3757:Scn11a	UTSW	9	119803503	missense	probably benign	0.16
R3767:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R3770:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R4089:Scn11a	UTSW	9	119795653	splice site	probably null
R4092:Scn11a	UTSW	9	119789970	missense	probably benign	0.03
R4247:Scn11a	UTSW	9	119807886	missense	probably damaging	1.00
R4279:Scn11a	UTSW	9	119754362	missense	probably benign	0.25
R4299:Scn11a	UTSW	9	119765506	missense	probably damaging	0.97
R4403:Scn11a	UTSW	9	119795667	missense	probably damaging	1.00
R4468:Scn11a	UTSW	9	119754987	missense	probably damaging	1.00
R4542:Scn11a	UTSW	9	119755134	missense	probably damaging	1.00
R4644:Scn11a	UTSW	9	119815203	splice site	probably null
R4739:Scn11a	UTSW	9	119754561	missense	probably benign	0.39
R4809:Scn11a	UTSW	9	119819870	missense	probably benign	0.00
R4954:Scn11a	UTSW	9	119758659	missense	possibly damaging	0.84
R5012:Scn11a	UTSW	9	119780878	missense	probably benign	0.31
R5044:Scn11a	UTSW	9	119819831	missense	probably damaging	0.98
R5222:Scn11a	UTSW	9	119815202	splice site	probably null
R5224:Scn11a	UTSW	9	119754792	missense	probably damaging	1.00
R5400:Scn11a	UTSW	9	119769908	missense	probably damaging	0.97
R5555:Scn11a	UTSW	9	119755238	missense	probably damaging	1.00
R5711:Scn11a	UTSW	9	119789924	missense	probably damaging	1.00
R5950:Scn11a	UTSW	9	119811124	missense	probably damaging	1.00
R5984:Scn11a	UTSW	9	119784016	missense	probably benign
R6057:Scn11a	UTSW	9	119765448	missense	probably damaging	1.00
R6104:Scn11a	UTSW	9	119795678	missense	probably damaging	1.00
R6180:Scn11a	UTSW	9	119754867	missense	probably benign	0.00
R6892:Scn11a	UTSW	9	119806969	missense	possibly damaging	0.53
R6908:Scn11a	UTSW	9	119792426	missense	probably damaging	1.00
R6949:Scn11a	UTSW	9	119765514	missense	probably benign	0.04
R7232:Scn11a	UTSW	9	119759916	missense	probably damaging	1.00
R7261:Scn11a	UTSW	9	119819833	missense	probably damaging	0.99
R7265:Scn11a	UTSW	9	119815265	missense	probably damaging	1.00
R7302:Scn11a	UTSW	9	119806951	missense	probably benign	0.03
R7391:Scn11a	UTSW	9	119795717	missense	probably damaging	1.00
R7441:Scn11a	UTSW	9	119758626	missense	probably benign	0.01
R7479:Scn11a	UTSW	9	119759875	missense	probably benign	0.38
R7608:Scn11a	UTSW	9	119815313	splice site	probably null
R7768:Scn11a	UTSW	9	119815272	missense	probably benign	0.13
R7785:Scn11a	UTSW	9	119816556	missense	probably benign	0.00
R7794:Scn11a	UTSW	9	119765514	missense	probably damaging	0.99
R7818:Scn11a	UTSW	9	119784111	missense	probably damaging	0.97
R7884:Scn11a	UTSW	9	119804551	missense	probably benign	0.01
R7988:Scn11a	UTSW	9	119765437	missense	probably damaging	0.97
R8049:Scn11a	UTSW	9	119755083	missense	probably damaging	1.00
R8127:Scn11a	UTSW	9	119804512	missense	probably damaging	1.00
R8274:Scn11a	UTSW	9	119803482	missense	probably benign
R8344:Scn11a	UTSW	9	119781970	missense	probably benign	0.00
R8346:Scn11a	UTSW	9	119778981	missense	probably damaging	1.00
R8511:Scn11a	UTSW	9	119789915	missense	probably damaging	0.99
R8819:Scn11a	UTSW	9	119816520	missense	probably benign	0.19
R8820:Scn11a	UTSW	9	119816520	missense	probably benign	0.19
R8837:Scn11a	UTSW	9	119792344	missense	probably damaging	1.00
R8913:Scn11a	UTSW	9	119794028	missense	probably damaging	1.00
R8915:Scn11a	UTSW	9	119774297	nonsense	probably null
R8975:Scn11a	UTSW	9	119758499	missense	probably damaging	1.00
R9156:Scn11a	UTSW	9	119759923	missense	possibly damaging	0.75
R9222:Scn11a	UTSW	9	119781947	missense	probably damaging	0.98
R9355:Scn11a	UTSW	9	119755094	missense	probably damaging	1.00
R9486:Scn11a	UTSW	9	119795708	missense	possibly damaging	0.86
R9712:Scn11a	UTSW	9	119790010	nonsense	probably null
R9766:Scn11a	UTSW	9	119755115	missense	probably damaging	1.00
Z1088:Scn11a	UTSW	9	119755242	missense	probably damaging	1.00
Z1177:Scn11a	UTSW	9	119754998	missense	possibly damaging	0.94
Z1177:Scn11a	UTSW	9	119819820	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGAAACCTGTTGGGCTTGG -3'
(R):5'- TTGACACTTTCTCGGGCAGC -3'

Sequencing Primer
(F):5'- GCTTGGCCACACGCAAC -3'
(R):5'- TTCTCGGGCAGCATGCTC -3'

Posted On

2019-05-15