Mutagenetix > Incidental Mutations

Incidental Mutation 'R7112:Vmn2r91'

551587

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r91

Ensembl Gene

ENSMUSG00000091206

Gene Name

vomeronasal 2, receptor 91

Synonyms

EG665210

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R7112 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18085057-18136643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18105618 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 166 (Q166L)

Ref Sequence

ENSEMBL: ENSMUSP00000127465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172359]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172359
AA Change: Q166L

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: Q166L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	83	462	2.2e-38	PFAM
Pfam:NCD3G	510	564	6.7e-20	PFAM
Pfam:7tm_3	597	832	2.1e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	G	T	12: 112,783,119	A1036E		Het
Baz2b	A	T	2: 59,962,184	H533Q	possibly damaging	Het
Bcl2l11	T	A	2: 128,158,315	W193R	probably damaging	Het
Bcl2l12	C	T	7: 44,996,914	G24D	probably damaging	Het
Cacna1b	A	G	2: 24,690,761	V691A	probably damaging	Het
Cdh8	T	C	8: 99,196,352	D304G	probably damaging	Het
Ces3a	A	T	8: 105,057,962	Q525H	probably damaging	Het
Csmd1	C	A	8: 16,101,128	C1391F	probably damaging	Het
Cul7	G	T	17: 46,651,698	G85V	probably damaging	Het
Dnah8	G	A	17: 30,871,392	V4623I	possibly damaging	Het
Dnhd1	T	A	7: 105,713,985	L3918Q	probably damaging	Het
Exoc4	A	T	6: 33,921,488	N881Y	probably damaging	Het
Flt1	G	C	5: 147,603,569	A770G	probably damaging	Het
Fndc5	A	G	4: 129,142,122	N184S	probably benign	Het
Folh1	A	G	7: 86,775,637		probably null	Het
Frem3	A	T	8: 80,612,031	T318S	probably damaging	Het
Gba2	A	G	4: 43,568,453	V671A	probably benign	Het
Gm7102	T	G	19: 61,175,559	D146A	probably damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Jph2	G	A	2: 163,375,784	T324M	probably damaging	Het
Kank4	A	G	4: 98,761,521	V937A	probably damaging	Het
Kdm3a	T	A	6: 71,632,170	E24D	probably benign	Het
Kidins220	T	A	12: 25,004,019	L464Q	probably damaging	Het
Loxhd1	T	A	18: 77,388,514	V1159E	probably damaging	Het
Malrd1	A	G	2: 15,925,176	N1498D	unknown	Het
Mrgprb5	C	T	7: 48,168,907	V27I	probably benign	Het
Mtfr2	A	G	10: 20,357,566	N294D	probably damaging	Het
Muc6	A	T	7: 141,649,277	L498H	probably damaging	Het
N4bp2	A	G	5: 65,790,707	T227A	possibly damaging	Het
Nin	C	T	12: 70,102,799	R12Q		Het
Obscn	G	C	11: 59,029,325	A27G		Het
Olfr284	T	A	15: 98,340,540	M150L	possibly damaging	Het
Olfr582	G	A	7: 103,041,655	D54N	probably damaging	Het
Olfr729	T	G	14: 50,147,935	E313A	probably benign	Het
Olfr746	T	A	14: 50,654,126	D296E	probably benign	Het
Olfr912	T	A	9: 38,582,034	Y252*	probably null	Het
Polr2a	A	G	11: 69,735,309	S1672P	unknown	Het
Qprt	A	G	7: 127,108,189	V245A	probably damaging	Het
Rab11fip5	T	A	6: 85,348,194	E377V	probably damaging	Het
Rere	A	G	4: 150,406,604	T71A	probably benign	Het
Ret	A	T	6: 118,197,102	L11Q	possibly damaging	Het
Rp1	C	T	1: 4,349,018	V624I	probably benign	Het
Scaf8	T	A	17: 3,163,029	L131H	unknown	Het
Scgb2a2	A	G	19: 9,851,657	R58G	probably benign	Het
Scn11a	A	G	9: 119,754,809	I1580T	probably damaging	Het
Slco4c1	T	G	1: 96,841,141	K332T	probably damaging	Het
Sntg1	T	G	1: 8,448,065	Y368S	possibly damaging	Het
Stim1	A	G	7: 102,408,408	T143A	probably benign	Het
Tbr1	A	G	2: 61,811,816	D475G	probably benign	Het
Tcp1	A	G	17: 12,917,873	D47G	probably damaging	Het
Tpgs2	T	C	18: 25,149,137	D119G	probably damaging	Het
Trim40	C	A	17: 36,882,642	R225M	probably null	Het
Tro	GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	X: 150,645,856		probably benign	Het
Trpm1	A	T	7: 64,235,845	N870Y	probably damaging	Het
Tsr3	A	G	17: 25,240,471	D47G	probably benign	Het
Vil1	G	A	1: 74,416,002	G38R	probably damaging	Het
Wdr33	C	T	18: 31,893,003	T919I	unknown	Het
Wdr36	T	C	18: 32,839,451	V64A	probably benign	Het
Xpnpep1	T	C	19: 53,010,107	I237V	probably benign	Het
Zfp780b	A	T	7: 27,963,141	I663N	probably damaging	Het
Zfyve9	G	A	4: 108,650,322	A513V	probably benign	Het

Other mutations in Vmn2r91

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Vmn2r91	APN	17	18105558	missense	probably benign	0.00
IGL01121:Vmn2r91	APN	17	18136504	missense	possibly damaging	0.94
IGL01464:Vmn2r91	APN	17	18107602	missense	probably null	0.00
IGL02003:Vmn2r91	APN	17	18107659	missense	probably benign
IGL02709:Vmn2r91	APN	17	18105449	missense	possibly damaging	0.74
IGL02795:Vmn2r91	APN	17	18085277	missense	probably benign	0.01
IGL02813:Vmn2r91	APN	17	18136086	missense	possibly damaging	0.91
IGL02830:Vmn2r91	APN	17	18136622	missense	probably benign	0.01
IGL03130:Vmn2r91	APN	17	18110111	splice site	probably benign
BB006:Vmn2r91	UTSW	17	18107644	missense	probably damaging	1.00
BB016:Vmn2r91	UTSW	17	18107644	missense	probably damaging	1.00
R0164:Vmn2r91	UTSW	17	18106137	missense	probably benign	0.00
R0164:Vmn2r91	UTSW	17	18106137	missense	probably benign	0.00
R0393:Vmn2r91	UTSW	17	18105450	missense	probably damaging	1.00
R1142:Vmn2r91	UTSW	17	18136443	missense	probably damaging	1.00
R1603:Vmn2r91	UTSW	17	18106143	missense	probably benign	0.04
R1992:Vmn2r91	UTSW	17	18135880	missense	probably damaging	1.00
R2182:Vmn2r91	UTSW	17	18105429	missense	possibly damaging	0.94
R2424:Vmn2r91	UTSW	17	18136169	nonsense	probably null
R2512:Vmn2r91	UTSW	17	18135786	missense	probably benign
R2885:Vmn2r91	UTSW	17	18105366	missense	probably benign	0.00
R2909:Vmn2r91	UTSW	17	18136399	missense	probably damaging	1.00
R3009:Vmn2r91	UTSW	17	18105455	missense	probably benign	0.11
R3079:Vmn2r91	UTSW	17	18135711	splice site	probably null
R3080:Vmn2r91	UTSW	17	18135711	splice site	probably null
R3434:Vmn2r91	UTSW	17	18110108	splice site	probably benign
R3723:Vmn2r91	UTSW	17	18085278	critical splice donor site	probably null
R3829:Vmn2r91	UTSW	17	18105497	missense	probably damaging	1.00
R3845:Vmn2r91	UTSW	17	18107598	missense	probably benign	0.00
R3846:Vmn2r91	UTSW	17	18107598	missense	probably benign	0.00
R4118:Vmn2r91	UTSW	17	18110096	missense	probably damaging	1.00
R4285:Vmn2r91	UTSW	17	18135768	missense	probably benign	0.00
R4729:Vmn2r91	UTSW	17	18107644	missense	probably damaging	1.00
R4793:Vmn2r91	UTSW	17	18105396	missense	probably damaging	1.00
R4932:Vmn2r91	UTSW	17	18136489	missense	possibly damaging	0.84
R5016:Vmn2r91	UTSW	17	18110060	nonsense	probably null
R5018:Vmn2r91	UTSW	17	18136438	missense	probably damaging	1.00
R5605:Vmn2r91	UTSW	17	18136501	missense	probably damaging	1.00
R5815:Vmn2r91	UTSW	17	18106202	missense	probably benign	0.01
R6146:Vmn2r91	UTSW	17	18136256	missense	probably benign	0.07
R6187:Vmn2r91	UTSW	17	18106626	missense	probably benign	0.05
R6426:Vmn2r91	UTSW	17	18135603	splice site	probably null
R6450:Vmn2r91	UTSW	17	18085265	missense	probably damaging	0.98
R6767:Vmn2r91	UTSW	17	18107545	missense	probably damaging	0.98
R6986:Vmn2r91	UTSW	17	18136009	missense	probably benign	0.10
R7178:Vmn2r91	UTSW	17	18136162	missense	probably damaging	1.00
R7330:Vmn2r91	UTSW	17	18106167	missense	probably damaging	1.00
R7368:Vmn2r91	UTSW	17	18136278	missense	possibly damaging	0.75
R7380:Vmn2r91	UTSW	17	18136576	nonsense	probably null
R7397:Vmn2r91	UTSW	17	18135798	missense	probably benign	0.02
R7625:Vmn2r91	UTSW	17	18105431	missense	probably damaging	1.00
R7739:Vmn2r91	UTSW	17	18135818	missense	probably benign	0.00
R7749:Vmn2r91	UTSW	17	18136278	missense	possibly damaging	0.75
R7755:Vmn2r91	UTSW	17	18110049	missense	possibly damaging	0.88
R7929:Vmn2r91	UTSW	17	18107644	missense	probably damaging	1.00
R7981:Vmn2r91	UTSW	17	18107625	missense	probably benign	0.02
R8211:Vmn2r91	UTSW	17	18106500	missense	probably damaging	1.00
R8325:Vmn2r91	UTSW	17	18136363	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCCAACACATCTCTTGGATTTG -3'
(R):5'- ACCTGGCTCATTGACAACAC -3'

Sequencing Primer
(F):5'- CAACACATCTCTTGGATTTGATTTC -3'
(R):5'- GGCTCATTGACAACACCAACCTTTC -3'

Posted On

2019-05-15