Mutagenetix > Incidental Mutations

Incidental Mutation 'R7112:Loxhd1'

551595

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7112 (G1)

Quality Score

183.009

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77388514 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1159 (V1159E)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: V1159E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: V1159E

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123410
AA Change: V293E

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: V293E

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148341
AA Change: V1050E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: V1050E

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	G	T	12: 112,783,119	A1036E		Het
Baz2b	A	T	2: 59,962,184	H533Q	possibly damaging	Het
Bcl2l11	T	A	2: 128,158,315	W193R	probably damaging	Het
Bcl2l12	C	T	7: 44,996,914	G24D	probably damaging	Het
Cacna1b	A	G	2: 24,690,761	V691A	probably damaging	Het
Cdh8	T	C	8: 99,196,352	D304G	probably damaging	Het
Ces3a	A	T	8: 105,057,962	Q525H	probably damaging	Het
Csmd1	C	A	8: 16,101,128	C1391F	probably damaging	Het
Cul7	G	T	17: 46,651,698	G85V	probably damaging	Het
Dnah8	G	A	17: 30,871,392	V4623I	possibly damaging	Het
Dnhd1	T	A	7: 105,713,985	L3918Q	probably damaging	Het
Exoc4	A	T	6: 33,921,488	N881Y	probably damaging	Het
Flt1	G	C	5: 147,603,569	A770G	probably damaging	Het
Fndc5	A	G	4: 129,142,122	N184S	probably benign	Het
Folh1	A	G	7: 86,775,637		probably null	Het
Frem3	A	T	8: 80,612,031	T318S	probably damaging	Het
Gba2	A	G	4: 43,568,453	V671A	probably benign	Het
Gm7102	T	G	19: 61,175,559	D146A	probably damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Jph2	G	A	2: 163,375,784	T324M	probably damaging	Het
Kank4	A	G	4: 98,761,521	V937A	probably damaging	Het
Kdm3a	T	A	6: 71,632,170	E24D	probably benign	Het
Kidins220	T	A	12: 25,004,019	L464Q	probably damaging	Het
Malrd1	A	G	2: 15,925,176	N1498D	unknown	Het
Mrgprb5	C	T	7: 48,168,907	V27I	probably benign	Het
Mtfr2	A	G	10: 20,357,566	N294D	probably damaging	Het
Muc6	A	T	7: 141,649,277	L498H	probably damaging	Het
N4bp2	A	G	5: 65,790,707	T227A	possibly damaging	Het
Nin	C	T	12: 70,102,799	R12Q		Het
Obscn	G	C	11: 59,029,325	A27G		Het
Olfr284	T	A	15: 98,340,540	M150L	possibly damaging	Het
Olfr582	G	A	7: 103,041,655	D54N	probably damaging	Het
Olfr729	T	G	14: 50,147,935	E313A	probably benign	Het
Olfr746	T	A	14: 50,654,126	D296E	probably benign	Het
Olfr912	T	A	9: 38,582,034	Y252*	probably null	Het
Polr2a	A	G	11: 69,735,309	S1672P	unknown	Het
Qprt	A	G	7: 127,108,189	V245A	probably damaging	Het
Rab11fip5	T	A	6: 85,348,194	E377V	probably damaging	Het
Rere	A	G	4: 150,406,604	T71A	probably benign	Het
Ret	A	T	6: 118,197,102	L11Q	possibly damaging	Het
Rp1	C	T	1: 4,349,018	V624I	probably benign	Het
Scaf8	T	A	17: 3,163,029	L131H	unknown	Het
Scgb2a2	A	G	19: 9,851,657	R58G	probably benign	Het
Scn11a	A	G	9: 119,754,809	I1580T	probably damaging	Het
Slco4c1	T	G	1: 96,841,141	K332T	probably damaging	Het
Sntg1	T	G	1: 8,448,065	Y368S	possibly damaging	Het
Stim1	A	G	7: 102,408,408	T143A	probably benign	Het
Tbr1	A	G	2: 61,811,816	D475G	probably benign	Het
Tcp1	A	G	17: 12,917,873	D47G	probably damaging	Het
Tpgs2	T	C	18: 25,149,137	D119G	probably damaging	Het
Trim40	C	A	17: 36,882,642	R225M	probably null	Het
Tro	GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC	X: 150,645,856		probably benign	Het
Trpm1	A	T	7: 64,235,845	N870Y	probably damaging	Het
Tsr3	A	G	17: 25,240,471	D47G	probably benign	Het
Vil1	G	A	1: 74,416,002	G38R	probably damaging	Het
Vmn2r91	A	T	17: 18,105,618	Q166L	possibly damaging	Het
Wdr33	C	T	18: 31,893,003	T919I	unknown	Het
Wdr36	T	C	18: 32,839,451	V64A	probably benign	Het
Xpnpep1	T	C	19: 53,010,107	I237V	probably benign	Het
Zfp780b	A	T	7: 27,963,141	I663N	probably damaging	Het
Zfyve9	G	A	4: 108,650,322	A513V	probably benign	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGTTGTCCCCTATGAGATCAC -3'
(R):5'- TTGGTATGCCTGTCTCCCAAG -3'

Sequencing Primer
(F):5'- TATGAGATCACCCTCTACACCAGTG -3'
(R):5'- TTAACCCTGACAACTTGTCCTAAATG -3'

Posted On

2019-05-15