Incidental Mutation 'R7112:Loxhd1'
ID551595
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7112 (G1)
Quality Score183.009
Status Not validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77388514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1159 (V1159E)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]
Predicted Effect probably damaging
Transcript: ENSMUST00000096547
AA Change: V1159E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: V1159E

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123410
AA Change: V293E

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: V293E

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148341
AA Change: V1050E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: V1050E

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Cdh8 T C 8: 99,196,352 D304G probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Malrd1 A G 2: 15,925,176 N1498D unknown Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Slco4c1 T G 1: 96,841,141 K332T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Stim1 A G 7: 102,408,408 T143A probably benign Het
Tbr1 A G 2: 61,811,816 D475G probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7967:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTTGTCCCCTATGAGATCAC -3'
(R):5'- TTGGTATGCCTGTCTCCCAAG -3'

Sequencing Primer
(F):5'- TATGAGATCACCCTCTACACCAGTG -3'
(R):5'- TTAACCCTGACAACTTGTCCTAAATG -3'
Posted On2019-05-15