Incidental Mutation 'R7112:Xpnpep1'
ID 551597
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission 045204-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52998538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 237 (I237V)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182097
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: I237V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: I237V

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: I237V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: I237V

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,747,747 (GRCm39) A1036E Het
Baz2b A T 2: 59,792,528 (GRCm39) H533Q possibly damaging Het
Bcl2l11 T A 2: 128,000,235 (GRCm39) W193R probably damaging Het
Bcl2l12 C T 7: 44,646,338 (GRCm39) G24D probably damaging Het
Cacna1b A G 2: 24,580,773 (GRCm39) V691A probably damaging Het
Cdh8 T C 8: 99,922,984 (GRCm39) D304G probably damaging Het
Ces3a A T 8: 105,784,594 (GRCm39) Q525H probably damaging Het
Csmd1 C A 8: 16,151,142 (GRCm39) C1391F probably damaging Het
Cul7 G T 17: 46,962,624 (GRCm39) G85V probably damaging Het
Dnah8 G A 17: 31,090,366 (GRCm39) V4623I possibly damaging Het
Dnhd1 T A 7: 105,363,192 (GRCm39) L3918Q probably damaging Het
Exoc4 A T 6: 33,898,423 (GRCm39) N881Y probably damaging Het
Flt1 G C 5: 147,540,379 (GRCm39) A770G probably damaging Het
Fndc5 A G 4: 129,035,915 (GRCm39) N184S probably benign Het
Folh1 A G 7: 86,424,845 (GRCm39) probably null Het
Frem3 A T 8: 81,338,660 (GRCm39) T318S probably damaging Het
Gba2 A G 4: 43,568,453 (GRCm39) V671A probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Jph2 G A 2: 163,217,704 (GRCm39) T324M probably damaging Het
Kank4 A G 4: 98,649,758 (GRCm39) V937A probably damaging Het
Kdm3a T A 6: 71,609,154 (GRCm39) E24D probably benign Het
Kidins220 T A 12: 25,054,018 (GRCm39) L464Q probably damaging Het
Loxhd1 T A 18: 77,476,210 (GRCm39) V1159E probably damaging Het
Malrd1 A G 2: 15,929,987 (GRCm39) N1498D unknown Het
Mplkipl1 T G 19: 61,163,997 (GRCm39) D146A probably damaging Het
Mrgprb5 C T 7: 47,818,655 (GRCm39) V27I probably benign Het
Mtfr2 A G 10: 20,233,312 (GRCm39) N294D probably damaging Het
Muc6 A T 7: 141,235,542 (GRCm39) L498H probably damaging Het
N4bp2 A G 5: 65,948,050 (GRCm39) T227A possibly damaging Het
Nin C T 12: 70,149,573 (GRCm39) R12Q Het
Obscn G C 11: 58,920,151 (GRCm39) A27G Het
Or11h7 T A 14: 50,891,583 (GRCm39) D296E probably benign Het
Or4k5 T G 14: 50,385,392 (GRCm39) E313A probably benign Het
Or52r1b G A 7: 102,690,862 (GRCm39) D54N probably damaging Het
Or8b48 T A 9: 38,493,330 (GRCm39) Y252* probably null Het
Or8s5 T A 15: 98,238,421 (GRCm39) M150L possibly damaging Het
Polr2a A G 11: 69,626,135 (GRCm39) S1672P unknown Het
Qprt A G 7: 126,707,361 (GRCm39) V245A probably damaging Het
Rab11fip5 T A 6: 85,325,176 (GRCm39) E377V probably damaging Het
Rere A G 4: 150,491,061 (GRCm39) T71A probably benign Het
Ret A T 6: 118,174,063 (GRCm39) L11Q possibly damaging Het
Rp1 C T 1: 4,419,241 (GRCm39) V624I probably benign Het
Scaf8 T A 17: 3,213,304 (GRCm39) L131H unknown Het
Scgb2a2 A G 19: 9,829,021 (GRCm39) R58G probably benign Het
Scn11a A G 9: 119,583,875 (GRCm39) I1580T probably damaging Het
Slco4c1 T G 1: 96,768,866 (GRCm39) K332T probably damaging Het
Sntg1 T G 1: 8,518,289 (GRCm39) Y368S possibly damaging Het
Stim1 A G 7: 102,057,615 (GRCm39) T143A probably benign Het
Tbr1 A G 2: 61,642,160 (GRCm39) D475G probably benign Het
Tcp1 A G 17: 13,136,760 (GRCm39) D47G probably damaging Het
Tpgs2 T C 18: 25,282,194 (GRCm39) D119G probably damaging Het
Trim40 C A 17: 37,193,534 (GRCm39) R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 149,428,852 (GRCm39) probably benign Het
Trpm1 A T 7: 63,885,593 (GRCm39) N870Y probably damaging Het
Tsr3 A G 17: 25,459,445 (GRCm39) D47G probably benign Het
Vil1 G A 1: 74,455,161 (GRCm39) G38R probably damaging Het
Vmn2r91 A T 17: 18,325,880 (GRCm39) Q166L possibly damaging Het
Wdr33 C T 18: 32,026,056 (GRCm39) T919I unknown Het
Wdr36 T C 18: 32,972,504 (GRCm39) V64A probably benign Het
Zfp780b A T 7: 27,662,566 (GRCm39) I663N probably damaging Het
Zfyve9 G A 4: 108,507,519 (GRCm39) A513V probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCTGTGTTAGCTGGCATCTG -3'
(R):5'- TCAGGTGACTTGGCAGAGTTC -3'

Sequencing Primer
(F):5'- GCTCTCTGGTTTCAGGACACTG -3'
(R):5'- TCTTCTGAAGGGATGGACAGGC -3'
Posted On 2019-05-15