Incidental Mutation 'R7113:Stpg2'
ID551609
Institutional Source Beutler Lab
Gene Symbol Stpg2
Ensembl Gene ENSMUSG00000047940
Gene Namesperm tail PG rich repeat containing 2
SynonymsLOC381476, B930007M17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location139205694-139710299 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 139701774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062306] [ENSMUST00000062306] [ENSMUST00000106239]
Predicted Effect probably null
Transcript: ENSMUST00000062306
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000062306
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106239
SMART Domains Protein: ENSMUSP00000101846
Gene: ENSMUSG00000047940

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 200 220 6.9e-1 PFAM
Pfam:SHIPPO-rpt 249 285 8.8e-2 PFAM
Pfam:SHIPPO-rpt 334 371 5.4e-2 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Stpg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Stpg2 APN 3 139419874 splice site probably benign
IGL01505:Stpg2 APN 3 139317453 missense probably benign 0.02
IGL01649:Stpg2 APN 3 139419862 missense probably damaging 1.00
IGL03264:Stpg2 APN 3 139309209 missense possibly damaging 0.72
PIT4687001:Stpg2 UTSW 3 139215265 missense possibly damaging 0.89
R0053:Stpg2 UTSW 3 139212321 missense probably benign 0.00
R0099:Stpg2 UTSW 3 139243193 splice site probably benign
R0417:Stpg2 UTSW 3 139218321 missense probably damaging 1.00
R1646:Stpg2 UTSW 3 139419702 splice site probably benign
R1719:Stpg2 UTSW 3 139232199 missense probably benign 0.11
R1791:Stpg2 UTSW 3 139317401 missense probably benign 0.00
R1799:Stpg2 UTSW 3 139419781 missense probably damaging 1.00
R1912:Stpg2 UTSW 3 139522981 splice site probably null
R1974:Stpg2 UTSW 3 139309183 nonsense probably null
R3725:Stpg2 UTSW 3 139317477 missense probably benign 0.00
R3727:Stpg2 UTSW 3 139298496 missense probably damaging 1.00
R4225:Stpg2 UTSW 3 139215292 missense probably damaging 0.97
R4694:Stpg2 UTSW 3 139317416 missense possibly damaging 0.94
R4698:Stpg2 UTSW 3 139309229 missense probably damaging 1.00
R4879:Stpg2 UTSW 3 139215373 missense probably benign 0.03
R5236:Stpg2 UTSW 3 139232223 missense probably damaging 1.00
R5476:Stpg2 UTSW 3 139243138 missense probably benign 0.03
R5567:Stpg2 UTSW 3 139419786 missense probably benign 0.22
R6297:Stpg2 UTSW 3 139701671 missense possibly damaging 0.91
R6692:Stpg2 UTSW 3 139522977 critical splice donor site probably null
R7154:Stpg2 UTSW 3 139215295 missense probably benign 0.44
R7553:Stpg2 UTSW 3 139218337 missense probably damaging 1.00
R7660:Stpg2 UTSW 3 139701697 missense probably damaging 0.98
RF021:Stpg2 UTSW 3 139212250 critical splice acceptor site probably null
X0009:Stpg2 UTSW 3 139298462 missense probably benign 0.00
X0018:Stpg2 UTSW 3 139243090 missense probably benign 0.44
Z1176:Stpg2 UTSW 3 139701640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCAAAATGACTCCTTTAAGGC -3'
(R):5'- CCAGGTACTAAAAGCAGATTAGCAGTC -3'

Sequencing Primer
(F):5'- CACAGCTCAGTCCATTTC -3'
(R):5'- TCTAATGTAGAAGCATGACGTGGC -3'
Posted On2019-05-15