Mutagenetix > Incidental Mutation

Incidental Mutation 'R7113:Cntln'

551612

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R7113 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85049827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 761 (E761G)

Ref Sequence

ENSEMBL: ENSMUSP00000044138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably damaging
Transcript: ENSMUST00000047023
AA Change: E761G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: E761G

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169371
AA Change: E761G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: E761G

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Meta Mutation Damage Score

0.0686

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

95% (53/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	T	C	13: 104,312,759	S226P	probably benign	Het
Adarb2	T	C	13: 8,731,845	Y586H	probably damaging	Het
Ano7	A	T	1: 93,385,620	E160V	probably benign	Het
Apob	G	C	12: 7,995,539	A895P	probably damaging	Het
Ccdc157	T	C	11: 4,148,889	T206A	possibly damaging	Het
Ceacam18	A	G	7: 43,641,976	N281D	probably benign	Het
Chil4	T	C	3: 106,202,767	D337G	probably damaging	Het
Chil4	T	G	3: 106,214,348	K62Q	probably benign	Het
Cic	A	T	7: 25,273,444	I867F	probably benign	Het
Cyp2d26	T	A	15: 82,790,202	Y493F	probably benign	Het
Dync2h1	A	T	9: 7,075,788	F3026L	probably benign	Het
Ehd3	T	A	17: 73,830,184	D449E	probably benign	Het
Gm5152	G	A	5: 10,243,010	P189S		Het
Gm884	A	G	11: 103,618,799	I781T	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Herc2	T	G	7: 56,203,849	D3696E	probably damaging	Het
Hivep3	T	A	4: 120,098,369	I1294N	probably damaging	Het
Il19	T	C	1: 130,934,995	I139V	probably benign	Het
Jmjd1c	T	A	10: 67,158,001	I87N	probably damaging	Het
Kcnma1	A	G	14: 23,463,156	Y392H	probably damaging	Het
Kcnv2	T	C	19: 27,324,048	L433P	probably damaging	Het
Kif9	A	T	9: 110,506,664	N378Y	probably damaging	Het
Lonrf1	A	T	8: 36,230,510	V440E	probably benign	Het
Manea	A	T	4: 26,336,718	L186Q	probably damaging	Het
Mas1	A	G	17: 12,842,437	I33T	probably benign	Het
Med13l	A	G	5: 118,726,265	S389G	probably benign	Het
Nxph3	T	C	11: 95,511,066	N174S	possibly damaging	Het
Olfr365	T	A	2: 37,201,556	F105Y	possibly damaging	Het
Olfr965	G	C	9: 39,719,677	C150S	probably benign	Het
Pcdha5	A	G	18: 36,961,704	D422G	probably benign	Het
Pias4	A	C	10: 81,154,453	V416G	possibly damaging	Het
Pik3cg	T	A	12: 32,205,667	Y107F	probably damaging	Het
Plcg1	T	A	2: 160,748,283	W156R	possibly damaging	Het
Plcl2	A	G	17: 50,606,464	D167G	probably damaging	Het
Podxl	T	A	6: 31,524,733		probably null	Het
Ppp1r2	T	C	16: 31,254,718	D197G	probably benign	Het
Ptprs	C	G	17: 56,451,697	V175L	probably benign	Het
Rad17	A	T	13: 100,629,517	S368T	probably benign	Het
Rdh8	G	T	9: 20,825,327	R230L	probably benign	Het
Rpl35	A	C	2: 39,004,156	L58R	probably damaging	Het
Rtp3	A	C	9: 110,986,699	C199W	probably damaging	Het
S100pbp	G	A	4: 129,182,103	T143I	probably damaging	Het
Scarf1	A	G	11: 75,526,078	E782G	probably damaging	Het
Slc30a9	T	C	5: 67,326,862	V114A	probably benign	Het
Stpg2	G	A	3: 139,701,774		probably null	Het
Tdpoz1	T	C	3: 93,670,806	S224G	possibly damaging	Het
Triml2	T	A	8: 43,183,333	Y52N	probably benign	Het
Trpm2	A	T	10: 77,947,931	I236N	probably damaging	Het
Unc5c	A	G	3: 141,801,293	D602G	probably benign	Het
Upk1a	A	G	7: 30,609,811	S29P	probably damaging	Het
Vmn2r54	A	G	7: 12,616,074	L527P	probably damaging	Het
Vmn2r72	A	T	7: 85,749,803		probably null	Het
Vstm2l	G	T	2: 157,914,729		probably benign	Het
Vwf	G	T	6: 125,655,044	G1952V		Het
Zfand6	A	C	7: 84,615,869	I208S	probably damaging	Het
Zfp236	A	G	18: 82,620,337	I1386T	possibly damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGGTCATTGAGTTGGAAAATCGG -3'
(R):5'- TCACCTTGGTAGTGGCTGTC -3'

Sequencing Primer
(F):5'- TGAGTTGGAAAATCGGCTAAAATC -3'
(R):5'- TGTCTTGCAGTCACAGCG -3'

Posted On

2019-05-15