Incidental Mutation 'R7113:Vwf'
ID 551619
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 045205-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7113 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 125632007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1952 (G1952V)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: G1952V

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,449,267 (GRCm39) S226P probably benign Het
Adarb2 T C 13: 8,781,881 (GRCm39) Y586H probably damaging Het
Ano7 A T 1: 93,313,342 (GRCm39) E160V probably benign Het
Apob G C 12: 8,045,539 (GRCm39) A895P probably damaging Het
Ccdc157 T C 11: 4,098,889 (GRCm39) T206A possibly damaging Het
Ceacam18 A G 7: 43,291,400 (GRCm39) N281D probably benign Het
Chil4 T C 3: 106,110,083 (GRCm39) D337G probably damaging Het
Chil4 T G 3: 106,121,664 (GRCm39) K62Q probably benign Het
Cic A T 7: 24,972,869 (GRCm39) I867F probably benign Het
Cntln A G 4: 84,968,064 (GRCm39) E761G probably damaging Het
Cyp2d26 T A 15: 82,674,403 (GRCm39) Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 (GRCm39) F3026L probably benign Het
Ehd3 T A 17: 74,137,179 (GRCm39) D449E probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Herc2 T G 7: 55,853,597 (GRCm39) D3696E probably damaging Het
Hivep3 T A 4: 119,955,566 (GRCm39) I1294N probably damaging Het
Il19 T C 1: 130,862,732 (GRCm39) I139V probably benign Het
Jmjd1c T A 10: 66,993,780 (GRCm39) I87N probably damaging Het
Kcnma1 A G 14: 23,513,224 (GRCm39) Y392H probably damaging Het
Kcnv2 T C 19: 27,301,448 (GRCm39) L433P probably damaging Het
Kif9 A T 9: 110,335,732 (GRCm39) N378Y probably damaging Het
Lonrf1 A T 8: 36,697,664 (GRCm39) V440E probably benign Het
Lrrc37 A G 11: 103,509,625 (GRCm39) I781T unknown Het
Manea A T 4: 26,336,718 (GRCm39) L186Q probably damaging Het
Mas1 A G 17: 13,061,324 (GRCm39) I33T probably benign Het
Med13l A G 5: 118,864,330 (GRCm39) S389G probably benign Het
Nxph3 T C 11: 95,401,892 (GRCm39) N174S possibly damaging Het
Or1l4 T A 2: 37,091,568 (GRCm39) F105Y possibly damaging Het
Or8g52 G C 9: 39,630,973 (GRCm39) C150S probably benign Het
Pcdha5 A G 18: 37,094,757 (GRCm39) D422G probably benign Het
Pias4 A C 10: 80,990,287 (GRCm39) V416G possibly damaging Het
Pik3cg T A 12: 32,255,666 (GRCm39) Y107F probably damaging Het
Plcg1 T A 2: 160,590,203 (GRCm39) W156R possibly damaging Het
Plcl2 A G 17: 50,913,492 (GRCm39) D167G probably damaging Het
Podxl T A 6: 31,501,668 (GRCm39) probably null Het
Ppp1r2 T C 16: 31,073,536 (GRCm39) D197G probably benign Het
Ptprs C G 17: 56,758,697 (GRCm39) V175L probably benign Het
Rad17 A T 13: 100,766,025 (GRCm39) S368T probably benign Het
Rdh8 G T 9: 20,736,623 (GRCm39) R230L probably benign Het
Rpl35 A C 2: 38,894,168 (GRCm39) L58R probably damaging Het
Rtp3 A C 9: 110,815,767 (GRCm39) C199W probably damaging Het
S100pbp G A 4: 129,075,896 (GRCm39) T143I probably damaging Het
Scarf1 A G 11: 75,416,904 (GRCm39) E782G probably damaging Het
Slc30a9 T C 5: 67,484,205 (GRCm39) V114A probably benign Het
Speer1c G A 5: 10,292,977 (GRCm39) P189S Het
Stpg2 G A 3: 139,407,535 (GRCm39) probably null Het
Tdpoz1 T C 3: 93,578,113 (GRCm39) S224G possibly damaging Het
Triml2 T A 8: 43,636,370 (GRCm39) Y52N probably benign Het
Trpm2 A T 10: 77,783,765 (GRCm39) I236N probably damaging Het
Unc5c A G 3: 141,507,054 (GRCm39) D602G probably benign Het
Upk1a A G 7: 30,309,236 (GRCm39) S29P probably damaging Het
Vmn2r54 A G 7: 12,350,001 (GRCm39) L527P probably damaging Het
Vmn2r72 A T 7: 85,399,011 (GRCm39) probably null Het
Vstm2l G T 2: 157,756,649 (GRCm39) probably benign Het
Zfand6 A C 7: 84,265,077 (GRCm39) I208S probably damaging Het
Zfp236 A G 18: 82,638,462 (GRCm39) I1386T possibly damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCGTCATGAATAGCTTGCTTAG -3'
(R):5'- ACGCCAGCATGCTTAATCTC -3'

Sequencing Primer
(F):5'- TACCATGTACCCTTGAAGTGTTG -3'
(R):5'- TCAATGGACTTCATGCAGGC -3'
Posted On 2019-05-15