Incidental Mutation 'R7113:Cic'
ID551621
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25273444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 867 (I867F)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]
Predicted Effect probably benign
Transcript: ENSMUST00000169266
AA Change: I867F

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: I867F

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169392
SMART Domains Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
R7680:Cic UTSW 7 25292431 missense probably damaging 0.96
R7698:Cic UTSW 7 25273172 missense possibly damaging 0.72
R7746:Cic UTSW 7 25288782 missense probably damaging 1.00
R7841:Cic UTSW 7 25285767 missense probably damaging 1.00
R7879:Cic UTSW 7 25285126 missense probably benign 0.10
R7924:Cic UTSW 7 25285767 missense probably damaging 1.00
R7962:Cic UTSW 7 25285126 missense probably benign 0.10
R8056:Cic UTSW 7 25290941 missense not run
V7732:Cic UTSW 7 25292245 missense probably benign
Z1176:Cic UTSW 7 25271019 missense not run
Predicted Primers PCR Primer
(F):5'- CACCTGTCATTGTCCGCAAC -3'
(R):5'- TCATCACCCTTGAAAGCCCG -3'

Sequencing Primer
(F):5'- ATTGTCCGCAACCCCGATG -3'
(R):5'- GGCCTGCCCATGATGACTTC -3'
Posted On2019-05-15