Incidental Mutation 'R7113:Lonrf1'
ID551626
Institutional Source Beutler Lab
Gene Symbol Lonrf1
Ensembl Gene ENSMUSG00000039633
Gene NameLON peptidase N-terminal domain and ring finger 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location36216064-36249516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36230510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 440 (V440E)
Ref Sequence ENSEMBL: ENSMUSP00000066403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065297]
Predicted Effect probably benign
Transcript: ENSMUST00000065297
AA Change: V440E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000066403
Gene: ENSMUSG00000039633
AA Change: V440E

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 161 N/A INTRINSIC
RING 193 228 1.57e-2 SMART
SCOP:d1elwa_ 274 387 3e-16 SMART
Blast:TPR 309 342 1e-14 BLAST
Blast:TPR 343 376 2e-15 BLAST
low complexity region 454 464 N/A INTRINSIC
RING 543 580 3.12e-6 SMART
Pfam:LON_substr_bdg 631 830 8e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Lonrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lonrf1 APN 8 36230077 splice site probably benign
IGL02195:Lonrf1 APN 8 36219948 nonsense probably null
IGL03087:Lonrf1 APN 8 36225551 splice site probably null
IGL03163:Lonrf1 APN 8 36230330 missense probably benign 0.03
IGL03225:Lonrf1 APN 8 36222701 missense probably damaging 0.96
BB009:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
BB019:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R0480:Lonrf1 UTSW 8 36222710 missense probably damaging 1.00
R0504:Lonrf1 UTSW 8 36231159 missense possibly damaging 0.93
R0557:Lonrf1 UTSW 8 36230420 missense probably benign 0.12
R1489:Lonrf1 UTSW 8 36222954 missense probably damaging 1.00
R1572:Lonrf1 UTSW 8 36233972 missense probably benign 0.02
R2225:Lonrf1 UTSW 8 36236098 missense probably damaging 0.98
R2345:Lonrf1 UTSW 8 36222862 critical splice donor site probably null
R4821:Lonrf1 UTSW 8 36219972 missense probably benign
R4934:Lonrf1 UTSW 8 36233949 missense probably damaging 1.00
R5538:Lonrf1 UTSW 8 36223024 critical splice acceptor site probably null
R6124:Lonrf1 UTSW 8 36229200 missense probably damaging 0.97
R6485:Lonrf1 UTSW 8 36229134 critical splice donor site probably null
R6603:Lonrf1 UTSW 8 36222941 missense probably damaging 1.00
R6886:Lonrf1 UTSW 8 36229037 splice site probably null
R7689:Lonrf1 UTSW 8 36248764 nonsense probably null
R7711:Lonrf1 UTSW 8 36249221 missense probably damaging 1.00
R7743:Lonrf1 UTSW 8 36249052 missense possibly damaging 0.72
R7932:Lonrf1 UTSW 8 36222916 missense probably benign 0.17
R8085:Lonrf1 UTSW 8 36248615 missense probably damaging 1.00
R8183:Lonrf1 UTSW 8 36222665 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACGTCCTGTTCTAAGAGAGACAG -3'
(R):5'- AGTCAGCATGATACCTAAGGCTC -3'

Sequencing Primer
(F):5'- CCTGTTCTAAGAGAGACAGCTTTCG -3'
(R):5'- GACAACAAACCCTTTACTTTCCTGG -3'
Posted On2019-05-15