Incidental Mutation 'R7113:Olfr965'
ID551631
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Nameolfactory receptor 965
SynonymsGA_x6K02T2PVTD-33416730-33417668, MOR171-28
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39711353-39720614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 39719677 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 150 (C150S)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
Predicted Effect probably benign
Transcript: ENSMUST00000069342
AA Change: C150S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: C150S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213335
AA Change: C150S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215164
AA Change: C150S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1505:Olfr965 UTSW 9 39719478 missense probably damaging 1.00
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4377:Olfr965 UTSW 9 39719807 missense probably benign 0.04
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5526:Olfr965 UTSW 9 39719596 missense possibly damaging 0.95
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
R7336:Olfr965 UTSW 9 39719610 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCTGGTGAACTTTGTGACAG -3'
(R):5'- GATTGTCAGCATTGGCACAC -3'

Sequencing Primer
(F):5'- TTGTGACAGAGAAGAACATCATCTCC -3'
(R):5'- TGGCACACAGAAATTAAAAGTACTG -3'
Posted On2019-05-15