Incidental Mutation 'R7113:Ppp1r2'
ID551648
Institutional Source Beutler Lab
Gene Symbol Ppp1r2
Ensembl Gene ENSMUSG00000047714
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31251537-31275277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31254718 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000060118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060188] [ENSMUST00000115233]
PDB Structure
rat PP1cgamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Rat pp1c gamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000060188
AA Change: D197G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000060118
Gene: ENSMUSG00000047714
AA Change: D197G

DomainStartEndE-ValueType
Pfam:IPP-2 46 174 6.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115233
SMART Domains Protein: ENSMUSP00000110888
Gene: ENSMUSG00000047714

DomainStartEndE-ValueType
Pfam:IPP-2 43 175 1.4e-61 PFAM
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice die during organogenesis. Heterozygous null mice display responses in behavioral assays suggesting enhanced memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vmn2r72 A T 7: 85,749,803 probably null Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Ppp1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Ppp1r2 UTSW 16 31258461 missense probably damaging 1.00
R2321:Ppp1r2 UTSW 16 31265303 critical splice donor site probably null
R4573:Ppp1r2 UTSW 16 31260637 missense possibly damaging 0.85
R6230:Ppp1r2 UTSW 16 31260600 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGTCTCTATGGTCTTAATTCTTGGC -3'
(R):5'- GCATGTTTCCCATACCTGGTTAAG -3'

Sequencing Primer
(F):5'- GGCAATATATAACTGGTGTGTACTC -3'
(R):5'- AGAGGCCTCACATGTCTGAG -3'
Posted On2019-05-15