Mutagenetix > Incidental Mutation

Incidental Mutation 'R7113:Plcl2'

551650

Institutional Source

Beutler Lab

Gene Symbol

Plcl2

Ensembl Gene

ENSMUSG00000038910

Gene Name

phospholipase C-like 2

Synonyms

PRIP-2, Plce2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R7113 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50509547-50688493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50606464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000046584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043938]

AlphaFold

Q8K394

Predicted Effect

probably damaging
Transcript: ENSMUST00000043938
AA Change: D167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: D167G

Domain	Start	End	E-Value	Type
low complexity region	20	49	N/A	INTRINSIC
PH	143	254	2.88e-5	SMART
Pfam:EF-hand_like	344	426	3.7e-29	PFAM
PLCXc	427	571	2.19e-84	SMART
PLCYc	619	735	4.37e-61	SMART
C2	756	862	3.45e-19	SMART

Meta Mutation Damage Score

0.2179

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

95% (53/56)

MGI Phenotype

PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	T	C	13: 104,312,759	S226P	probably benign	Het
Adarb2	T	C	13: 8,731,845	Y586H	probably damaging	Het
Ano7	A	T	1: 93,385,620	E160V	probably benign	Het
Apob	G	C	12: 7,995,539	A895P	probably damaging	Het
Ccdc157	T	C	11: 4,148,889	T206A	possibly damaging	Het
Ceacam18	A	G	7: 43,641,976	N281D	probably benign	Het
Chil4	T	C	3: 106,202,767	D337G	probably damaging	Het
Chil4	T	G	3: 106,214,348	K62Q	probably benign	Het
Cic	A	T	7: 25,273,444	I867F	probably benign	Het
Cntln	A	G	4: 85,049,827	E761G	probably damaging	Het
Cyp2d26	T	A	15: 82,790,202	Y493F	probably benign	Het
Dync2h1	A	T	9: 7,075,788	F3026L	probably benign	Het
Ehd3	T	A	17: 73,830,184	D449E	probably benign	Het
Gm5152	G	A	5: 10,243,010	P189S		Het
Gm884	A	G	11: 103,618,799	I781T	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Herc2	T	G	7: 56,203,849	D3696E	probably damaging	Het
Hivep3	T	A	4: 120,098,369	I1294N	probably damaging	Het
Il19	T	C	1: 130,934,995	I139V	probably benign	Het
Jmjd1c	T	A	10: 67,158,001	I87N	probably damaging	Het
Kcnma1	A	G	14: 23,463,156	Y392H	probably damaging	Het
Kcnv2	T	C	19: 27,324,048	L433P	probably damaging	Het
Kif9	A	T	9: 110,506,664	N378Y	probably damaging	Het
Lonrf1	A	T	8: 36,230,510	V440E	probably benign	Het
Manea	A	T	4: 26,336,718	L186Q	probably damaging	Het
Mas1	A	G	17: 12,842,437	I33T	probably benign	Het
Med13l	A	G	5: 118,726,265	S389G	probably benign	Het
Nxph3	T	C	11: 95,511,066	N174S	possibly damaging	Het
Olfr365	T	A	2: 37,201,556	F105Y	possibly damaging	Het
Olfr965	G	C	9: 39,719,677	C150S	probably benign	Het
Pcdha5	A	G	18: 36,961,704	D422G	probably benign	Het
Pias4	A	C	10: 81,154,453	V416G	possibly damaging	Het
Pik3cg	T	A	12: 32,205,667	Y107F	probably damaging	Het
Plcg1	T	A	2: 160,748,283	W156R	possibly damaging	Het
Podxl	T	A	6: 31,524,733		probably null	Het
Ppp1r2	T	C	16: 31,254,718	D197G	probably benign	Het
Ptprs	C	G	17: 56,451,697	V175L	probably benign	Het
Rad17	A	T	13: 100,629,517	S368T	probably benign	Het
Rdh8	G	T	9: 20,825,327	R230L	probably benign	Het
Rpl35	A	C	2: 39,004,156	L58R	probably damaging	Het
Rtp3	A	C	9: 110,986,699	C199W	probably damaging	Het
S100pbp	G	A	4: 129,182,103	T143I	probably damaging	Het
Scarf1	A	G	11: 75,526,078	E782G	probably damaging	Het
Slc30a9	T	C	5: 67,326,862	V114A	probably benign	Het
Stpg2	G	A	3: 139,701,774		probably null	Het
Tdpoz1	T	C	3: 93,670,806	S224G	possibly damaging	Het
Triml2	T	A	8: 43,183,333	Y52N	probably benign	Het
Trpm2	A	T	10: 77,947,931	I236N	probably damaging	Het
Unc5c	A	G	3: 141,801,293	D602G	probably benign	Het
Upk1a	A	G	7: 30,609,811	S29P	probably damaging	Het
Vmn2r54	A	G	7: 12,616,074	L527P	probably damaging	Het
Vmn2r72	A	T	7: 85,749,803		probably null	Het
Vstm2l	G	T	2: 157,914,729		probably benign	Het
Vwf	G	T	6: 125,655,044	G1952V		Het
Zfand6	A	C	7: 84,615,869	I208S	probably damaging	Het
Zfp236	A	G	18: 82,620,337	I1386T	possibly damaging	Het

Other mutations in Plcl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Plcl2	APN	17	50606920	missense	probably benign	0.01
IGL01746:Plcl2	APN	17	50607696	missense	probably benign	0.00
IGL02227:Plcl2	APN	17	50606397	missense	probably damaging	0.97
IGL02232:Plcl2	APN	17	50606641	missense	possibly damaging	0.66
IGL02878:Plcl2	APN	17	50607355	missense	probably damaging	1.00
IGL02985:Plcl2	APN	17	50687814	nonsense	probably null
acerbic	UTSW	17	50608113	missense	probably damaging	1.00
Balsamic	UTSW	17	50607661	missense	probably damaging	1.00
Bastante	UTSW	17	50606361	nonsense	probably null
italietta	UTSW	17	50608762	missense	probably damaging	1.00
Oxalic	UTSW	17	50608099	missense	probably damaging	1.00
Parece	UTSW	17	50607846	missense	probably damaging	0.99
picolinic	UTSW	17	50668160	splice site	probably null
ranch	UTSW	17	50509929	missense	probably benign	0.00
verdad	UTSW	17	50608081	missense	probably damaging	1.00
vinagrette	UTSW	17	50606856	nonsense	probably null
BB007:Plcl2	UTSW	17	50606803	missense	probably benign
BB017:Plcl2	UTSW	17	50606803	missense	probably benign
IGL03014:Plcl2	UTSW	17	50611001	missense	possibly damaging	0.65
R0110:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0190:Plcl2	UTSW	17	50607643	missense	probably benign
R0280:Plcl2	UTSW	17	50607034	missense	probably damaging	1.00
R0414:Plcl2	UTSW	17	50607955	missense	possibly damaging	0.90
R0450:Plcl2	UTSW	17	50607982	missense	probably damaging	1.00
R0760:Plcl2	UTSW	17	50608774	missense	possibly damaging	0.82
R1134:Plcl2	UTSW	17	50608110	missense	probably benign
R1168:Plcl2	UTSW	17	50607072	missense	possibly damaging	0.49
R1381:Plcl2	UTSW	17	50607729	missense	probably damaging	0.99
R1748:Plcl2	UTSW	17	50606798	missense	probably benign
R1856:Plcl2	UTSW	17	50607850	missense	probably benign	0.13
R1958:Plcl2	UTSW	17	50608081	missense	probably damaging	1.00
R2016:Plcl2	UTSW	17	50606694	missense	probably damaging	1.00
R2057:Plcl2	UTSW	17	50668111	splice site	probably null
R2077:Plcl2	UTSW	17	50606829	missense	probably benign
R2247:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R3083:Plcl2	UTSW	17	50687744	missense	probably benign	0.06
R4153:Plcl2	UTSW	17	50606361	nonsense	probably null
R4574:Plcl2	UTSW	17	50607846	missense	probably damaging	0.99
R4870:Plcl2	UTSW	17	50607226	missense	possibly damaging	0.46
R5030:Plcl2	UTSW	17	50607319	missense	possibly damaging	0.92
R5330:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5331:Plcl2	UTSW	17	50509848	missense	probably benign	0.01
R5503:Plcl2	UTSW	17	50509929	missense	probably benign	0.00
R5920:Plcl2	UTSW	17	50608675	missense	probably damaging	0.99
R6238:Plcl2	UTSW	17	50606845	missense	probably damaging	0.96
R6378:Plcl2	UTSW	17	50668160	splice site	probably null
R6603:Plcl2	UTSW	17	50607117	missense	probably benign	0.03
R6633:Plcl2	UTSW	17	50640140	missense	probably benign	0.00
R7466:Plcl2	UTSW	17	50608468	missense	probably damaging	1.00
R7665:Plcl2	UTSW	17	50607157	missense	probably benign	0.00
R7930:Plcl2	UTSW	17	50606803	missense	probably benign
R8114:Plcl2	UTSW	17	50687787	missense	probably damaging	0.97
R8152:Plcl2	UTSW	17	50607661	missense	probably damaging	1.00
R8208:Plcl2	UTSW	17	50608315	missense	probably damaging	1.00
R8853:Plcl2	UTSW	17	50606856	nonsense	probably null
R8911:Plcl2	UTSW	17	50608113	missense	probably damaging	1.00
R8940:Plcl2	UTSW	17	50608762	missense	probably damaging	1.00
R8979:Plcl2	UTSW	17	50640117	missense	possibly damaging	0.64
R9127:Plcl2	UTSW	17	50611004	missense	probably benign	0.05
R9253:Plcl2	UTSW	17	50608099	missense	probably damaging	1.00
R9453:Plcl2	UTSW	17	50608363	missense	probably damaging	1.00
R9469:Plcl2	UTSW	17	50606925	missense	probably benign	0.05
R9630:Plcl2	UTSW	17	50640119	missense	probably benign
X0026:Plcl2	UTSW	17	50607560	missense	probably benign	0.03
Z1088:Plcl2	UTSW	17	50606992	missense	probably damaging	1.00
Z1176:Plcl2	UTSW	17	50608456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTACACAGCTTTTCAGGG -3'
(R):5'- ACATCTGCAGAATTGGCAACC -3'

Sequencing Primer
(F):5'- CTTAGTCTGAACATGAACACCTATG -3'
(R):5'- TTGGCAACCAAATCAAGTGACTC -3'

Posted On

2019-05-15